DNA Aptamers as a molecular probe for diagnosis and therapeutic in
cancer cells
Hashemi Tabar, G.R1 ** and Smith, Cassandra L. 2
1- Department of Pathobiology, School of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad,
Iran.
2- Molecular Biotechnology Research Laboratory, Boston University, 44 Cummington Street, Boston, MA,
02215, USA.
Abstract
DNA aptamers are small single stranded DNA molecules that possess antibody-like characteristics; they bind
with high affinity to specific antigens as a result of their three dimensional structure and chemical properties.
Carcinoembryonic antigen (CEA) is expressed on the surface of 95% of adenocarcinomas. Anti-CEA antibodies
have been used diagnostically in vitro to monitor possible metastases and clinically for the treatment of tumors
in vivo.
The aim of this research was to isolate aptamers against CEA for vivo imaging and treatment of cancer cells.
Fluorescence polarization assay was used to measure affinity and specificity of the candidate aptamers
sequences towards purified CEA and related proteins. Additionally, we showed that these aptamers bind
specifically to CEA on the surface of cancerous cell lines: MCF7 (human breast adenocarcinoma). We also
demonstrated that CEA specific DNA aptamer does not bind to the surface of a CEA negative cell line:
COLO320DM (human colon adenocarcinoma). To detect the binding of our DNA aptamers to CEA on the
surface of cells, fluorescence microscopy was used.
Key words: Aptamer, Carcinoembryonic antigen, Cancer, fluorescence polarization.
Introduction
Aptamers are an emerging class of small molecule (<10 kDa) targeting reagents that are functional mimics of
antibodies (Cerchia et al., 2002). These molecules are identified through an in vitro selection protocol
(systematic evolution of ligands by exponenetial enrichment (SELEX) that interrogates using large pools of
random RNA or DNA sequences (Smith et al., 2007). Aptamers have been isolated against a wide range of
targets of small and large (macromolecular) targets and even whole cells. Aptamers are single-stranded (ss)
nucleic acids (i.e. DNA, RNA, and their modified forms) that fold into unique structure that have high binding
affinities for and specify selected targets. The Kd's of aptamers range between 10-7 and 10-12 making their
affinities and specificities comparable to, if not better than antibodies used in diagnostic application (Jayasena,
1999). CEA is a 180 kDa highly glycosylated, membrane-anchored, protein over-expressed on breast, ovarian,
colon and other cancer cells (Phillips et al., 2008). So far, no anti-CEA (Carcinoembryonic antigen ) aptamers
have been reported. CEA is, arguably, the best-studied tumor epitope and present on the largest number of
tumors. These, and other conditions, lead to an increase in blood CEA; hence, clinically, serum CEA levels may
be indicative (but not diagnostic) of the return of active metastatic disease (Gold et al., 1997). CEA belongs to
the CEA superfamily, a subset of the immunoglobulin (IG) superfamily with analogous constant and variable
regions 3 (Huang et al., 2008).
Materials and Methods
1-Samples
DNA sequences (aptamers) (Table 1) were obtained from Operon. The aptamers were selected from a
library of 100-base single stranded DNAs obtained from Operon Technologies, Alameda, Ca. The
100-base single stranded DNA library consisted of an internal 64 base variable region flanked by two
18 base constant sequences used as PCR primer sites. The constant sequences were chosen because
they lacked a secondary structure and did not anneal to each other (Crameri, 1993). CEA, obtained
from Calbiochem (La Jolla, Ca). Bovine gamma globulin (BGG) was provided by Pan Vera Corp.
(Madison WI) and bovine serum albumin (BSA) was from Sigma-Aldrich (Saint Louis MO). Horse,
Dog and Bovine IgGs were from Sigma-Aldrich, Saint Louis, MO, USA.
2- Fluorescent polarization
1
For fluorescent polarization (FP) measurements, the aptamers were labeled with fluorescein at their 5’
end during synthesis. The method for showing in vitro CEA binding is fluorescence polarization
analysis with a Pan Vera Beacon 2000 fluorescence polarization instrument. A fluorescently labeled
DNA aptamer held at constant concentration used with vary of the concentration of CEA in solution
with the aptamer.
3- Fluorescence microscopy
In another experiment, Cells (MCF7) were incubated at 37˚ C with 5%CO2 on a multi-well slide
overnight and then washed 3X with PBS. Cells were incubated for two hours at 4˚ C with deferent
aptamers either: COLO320DM (human colon adenocarcinoma as negative control), (consensus
sequence), b1-18 (5’ primer) (Table 1) and Ab(CEAab) (as positive control). All concentrations were
1uM in a total volume of 150 µL. Cells were then washed 3X with PBS on shaker for 5 min,
fluorsave mounting media was added to the slide and coverslips were placed on the slide. The slide
was then imaged immediately using both brightfield (left column) and fluorescence (right column)
microscopy. Unless otherwise noted total magnification was 600 x.
Table 1. Oligonucleotides sequences tested in the FP assay. The G-rich consensus was developed
from 21 occurrences in a selected library. Note that R= A or G bases highlighted in blue deviate from
the consensus. Primer sequence is shadowed and consensus sequence is underlined.
Oligonucleotides studied
Name
AGGGGGTGAAGGGATACCC
consensus sequence
GGGG G AGGGGGTGAAGGGATACCCG-rich-consensus sequence
ATACCAGCTTATTCAATTGGGGTAGGGGGCGAAGCGATACCCTAATCAGC c26b1-50
ATACCAGCTTATTCAATTGGGGGAGGGGGCGACGCGATACCC
c22b1-42
GGGGGAGGGGGCGACGCGATACCC
c22b19-42
ATACCAGCTTATTCAATT
b1-18 (5' primer)
CGGGAATTCTGGCTCTGCGACATGA
random sequence
Results and Discussion
Control experiments tested binding of the same DNAs to non-CEA proteins, and a random DNA
sequence binding to CEA. The FP assay was used to assess binding of the aptamers to control
proteins (Table 2) such us BSA, BGG, Dog IgG, Horse IgG and Bovine IgG. The Kd values were
found to be 100 respectively 1000-fold higher than those obtained for CEA (Table 2). The
fluorescein-labeled random DNA used as a negative control showed no binding to CEA in the 2-800
nM concentration ranges. The FP experiments revealed two disparate aptamer sequences (primer vs
consensus). Studies have been initiated to testing the specificity of aptamer binding to cells expessing
CEA. Our results showed that aptamers and also antibody bound to CEA expressing MCF7 cells
using fluorescence microscopy, while COLO320DM did not bind to aptamer (consensus sequence)
(figure 1).
Table 2. The dissociation constants (Kd) for the oligonucleotide binding to the CEA and control
proteins BSA and BGG.
Oligonucleotide
Name
[F]G-rich-consensus sequence
[Fl]Clone26bases1-50
[Fl]Clone22bases1-42
[Fl]Clone22bases19-42
[Fl]b1-18 (5’-Primer)
[Fl]Random Primer
CEA
2.63
2.86
2.26
3.04
0.69
>1000
Kd (nM-1)
BSA
BGG
not done 1500
969.3
1229
171.9
551.3
967.5
167.4
3366
488.4
1000 1000
*Dog/Horse/Bovine
2
IgG*
1000
1000
1000
1000
1000
1000
MCF7 with consensus sequence b
f
MCF 7 with b1-18 (5’ primer) b
f
MCF 7 with antibody
f
as a positive control b
COLO329DM (negative control)
f
with consensus sequence b
Figure 1:
Photographs were taken of the cells under light microscopy and superimposed on fluorescent
images. Images were collected and compared to those of the CEA negative control cell line and
adjustments in conditions made to optimize aptamer binding. MCF7 indicates as cancer cell, b as
bright and f as flourecense picture with fluorescence microscopy.
3
Aptamers against tumor cells or tumor-vessel endothelial cells may prove to be even more useful.
The developed anti-CEA aptamers may also be useful to use these reagents as in vitro diagnostic
tools. In such products, aptamers can play a key role either in conjunction with, or in place of,
antibodies. Also, these experiments also established an FP assay for the detection of CEA in
homogenous solutions. The assay was quick, highly selective, and can detect CEA in low nM range.
Results showed that two high affinity and specificity anti-CEA aptamers have been found that
deserve further study.
Our goal was to develop these reagents for in vivo targeting using
radionuclides for imaging and treatment regimes. The most critical step at this point is to determine
cross-reactivity with other CEA family proteins. Even if these molecules cross react with other
proteins they may be used to for the selection of specific aptamers. For instance, the current aptamers
could be linked to a variable DNA sequence and used to limit the effective volume of variable region
to the CEA location or other nearby tumor surface epitopes. Some experiments indicated excellent
binding to CEA expressing cells, while other experiment failed to show binding.
Acknowledgments
The study was financially supported by Ferdowsi University of Mashhad and is thanked from Molecular
Biotechnology Research Laboratory, Boston University, USA.
References
Crameri, A., Stemmer, W. P., (1993).10(20)-fold aptamer library amplification without gel purification, Nucleic
Acids Res., 21(18), , 4410.
Cerchia, L., Hamm, J., Libri, D., Tavitian, B., de Franciscis, V., (2002). Nucleic acid aptamers in cancer
medicine, FEBS Lett., 528(1-3) , 12-16.
Gold, L., Brown, D., He, Y., Shtatland, T., Singer, B. S.,Wu, Y., (1997). From oligonucleotide shapes to
genomic SELEX: Novel biological regulatory loops, P.N.A.S., USA , 94, 59-64.
Huang, Yu-Fen. Chang, Huan-Tsung and Tan, Weihong. (2008). Cancer Cell Targeting Using Multiple
Aptamers Conjugated on Nanorods. Anal. Chem., 80, 567-572.
Jayasena, S. D., (1999). Aptamers: An Emerging Class of Molecules That Rival Antibodies in Diagnostics, Clin.
Chem., 45,1628-1650.
Kuroki, M., Arakawa, F., Khare, PD., Kuroki, M., Liao, S., Matsumoto, H., Abe, H., Imakiire, T., (2000).
Specific targeting strategies of cancer gene therapy using a single-chain variable fragment (scFv) with a high
affinity for CEA, nticancer Res., 20(6A) , 4067-71.
Phillips, Joseph A., Lopez-Colon,Dalia., Zhu, Zhi., Xu, Ye. and Tan,Weihong. ((2008).
Applications of
aptamers in cancer cell biology. Analytica chimica acta. 6 2 1 101–108.
Smith, Joshua E. Medley, Colin D. Tang Zhiwen, Shangguan Dihua, Lofton,Charles. and Tan Weihong. (2007)
Aptamer-Conjugated Nanoparticles for the Collection and Detection of Multiple Cancer Cells. Anal. Chem., 79,
3075-3082.
4
‫تشخیص و درمان سلولهای سرطانی با استفاده از‬
‫اپتامرها‬
‫دكتر غالمرضا هاشمي تبار‪ **1‬و پروفسور‬
‫کسندرااسمبت‪2‬‬
‫‪-1‬گروه پاتوبيولوژي‪ ،‬دانشكده دامپزشكي‪ ،‬دانشگاه فردوسي مشهد‪،‬‬
‫مشهد‪ ،‬ايران‪.‬‬
‫‪ -2‬آزمايشگاه بيوتکنولوژی مولکولی‪،‬دانشکده مهندسی‪ ،‬بوستون‪،‬‬
‫آمريکا‪.‬‬
‫اپتامرها مولکولهای کوچک تک رنجيری هستند که خصوصيات شبیيه آن تی‬
‫بيات‬
‫بدی وخصوصب‬
‫به باب‬
‫باختان سب‬
‫به سب‬
‫با بانب‬
‫بو مولکولهب‬
‫بد‪ ،‬ايب‬
‫بادی دارنب‬
‫بب‬
‫بيوشيميايی با ميل ترکيیی زياد به آنتی ژنهای اختصاصبی متصبل مبی‬
‫شوند‪ .‬آنتی ژن کارسينوامیريونيک در سطح ‪ %59‬آدنوکارسبينومها بيبان‬
‫می شود‪ .‬آنتی باديهای ضد ايو آنتی ژن به صبورت ‪ in vitro‬ببرای تشبصي‬
‫متاستازهای احتمالی و به طور کنينيکی برای درمان تومورها به شبکل‬
‫‪ in vivo‬استفاده شده اسه‪ .‬هدف مطالاه حاضر جدا کردن اپتامرهبا لنيبه‬
‫آنتی ژن کارسينوامريونيک جهه تشصي و درمان سنولهای سرطانی ببود‪.‬‬
‫آزمايش پالريزاسيون فنوروسنس جهه انداره گيری ميل ترکيیی واختصاصی‬
‫با آنتبی ژن خبال کارسبينوامیريونيک انجباد شبد‪.‬‬
‫بودن اپتامرها بب‬
‫باالوه‪ ،‬اتصال اختصاصبی اپتامرهبا ببا آنتبی ژن کارسبينوامیريونيک‬
‫)‪ ) MCF7‬مورد بررسی قرار گرفه‪ .‬همچنيو نشبان داده شبد کبه اپتبامر‬
‫اختصاصی ببا نمونبه کنتبرل منفبی آنتبی ژن کارسبينو امیريونيبک‬
‫‪ ) COLO32ODM‬اتصال برقرار نکرد‪ .‬اتصال اپتبامر هبا ببه سبنولهای‬
‫سرطانی با ميکروسکوپ فنوروسنس مورد بررسی قرار گرفه‪.‬‬
‫ن کارسااینو آمبر ونیاا ‪ ،‬ساارطان‪،‬‬
‫کلماااک کلیاادی‪ :‬اپتااامر‪ ،‬آنتاای‬
‫پالر زاسیون فلوروسنس‪.‬‬
‫‪5‬‬