Xia et al. Nuclear Receptors and cholangiocyte cholesterol transport.
Supplementary data
Materials and Methods
Cells and reagents. Cholangiocytes and hepatocytes were isolated from rat liver as described by Alpini
(3)
. Briefly, after incannulation into the inferior caval vein, the liver was perfused retrogradely with Hank's
balanced salt solution (HBSS-CMF) containing 0.05% collagenase (Sigma, St. Louis, MO). Hepatocytes
were purified by centrifugation by Percoll density gradient separation. The parenchyma and portal tract
residue were minced into small pieces. The cell suspension was then separated into two subpopulations
based on size differences by counterflow elutriation using a Beckman J2-21 M centrifuge equipped with a
JE-6B rotor (Beckman, Fullerton, CA). The two subpopulations which consist of small and large
cholangiocytes were obtained at selected flow rates (25 and 55 mL/min). The resulting subpopulations
were further purified by a monoclonal antibody and cell viability was assessed as described (3).
Real-time qPCR and Northern Blot. For real-time qPCR, total RNA was purified using RNeasy mini
kit (Qiagen, Valencia ,CA) following manufacturer’s instructions. Each total RNA sample (0.2μg) was
reverse transcribed in a 20 μl reaction using 100 unit of SuperScript II Reverse Transcriptase and 8 Units
of RNase inhibitor (Applied Biosystems, Carlsbad, CA), 4.4 μl of 25 mM MgCl2, 2 μl 10X RT buffer, 1 μl
of 50 μM random hexamer and 4 μl of 10 mM of dNTP mix. Real-time qPCR used a cDNA equivalent of
40 ng total RNA in 25 μl using Platinum qPCR SuperMix-UDG (Invitrogen) and Taqman assay-onDemand probe and primer mix (Applied Biosystems) according to manufacturer’s instructions. PCR was
performed in triplicate using Taqman probes and 7900HT Fast Real Time PCR System (Applied
Biosystems). Amplification used a 2 minute step at 50˚C and a 2 minute denaturation step at 95˚C,
followed by 45 cycles of 15 s of denaturation at 95˚C, 30s of primer annealing, and a polymerization step
at 60˚C. To normalize for differences in the amount of total RNA in each RT-PCR, Cyclophilin E was
1
Xia et al. Nuclear Receptors and cholangiocyte cholesterol transport.
used as endogenous control. Relative expression in each sample was calculated in relation to standard
(non-treated sample of cDNA). For Northern blot, total RNA was extracted by Trizol reagent (Invitrogen)
according to manufacturer’s instructions. 10μg of RNA was denatured, electrophoresed, transferred to
Zeta-Probe membrane (Bio-Rad, Richmond, CA), and probed with labeled cDNA probe.
Immunohistochemistry and Immunofluorescence. Sham and BDL rats were generated as described
(3)
.Paraffin-embedded liver sections (4-µm) were dewaxed in xylene and rehydrated through graded
ethanol. Antigens were retrieved by boiling 10 mM citrate buffer (pH 6.0) for 5 minutes. Cooled sections
were incubated in 3% H2O2 in 50% methanol for 30 minutes and washed. Sections were incubated in
blocking buffer (PBS containing 1% BSA and 0.1% Nonidet P-40) for 1 h at 4º C and were incubated with
a specific goat antibody anti-LXR and PPARδ (1:100) in blocking buffer overnight at 4°C. After
washing, sections were incubated with rabbit anti-goat IgG (Zymed, South San Francisco, CA). The
Vectastain ABC kit (Vector, Burlingame, CA) was used for avidin-biotin complex method to visualize the
signal. Sections were developed with 3,3'-diaminobenzidine tetrahydrochloride substrate (DAKO,
Carpinteria, CA) and then counterstained with hematoxylin. ABCA1 or NPC1L1 expression was assessed
via indirect immunofluorescence.NRC cells were seeded on Lab-Tek Chamber slides (Nalge Nunc,
Rochester, NY).Slides were fixed in -20°C acetone for 10 minutes and washed. Slides were blocked with
1% normal sheep serum in 1x antibody dilution buffer (1% BSA in 0.3% Tween/PBS) for 1 hour and
incubated with 1:100 ABCA1 or NPC1L1 polyclonal antibody overnight at 4°C in a humid chamber.
After washing, slides were reprobed with goat anti-rabbit Alexa 488 (Invitrogen) for 1 hour at room
temperature in a dark humid chamber and then washed in 0.3% Tween/PBS for 10 minutes. Slides were
stained with propidium iodide and mounted with Gel/Mount for microscopy. Fluorescence microscopy
images were acquired with a Nikon 90i microscope outfitted with epifluorescence and Nikon A1 Cofocal
microscope. Samples without primary antibody were used as control.
2
Xia et al. Nuclear Receptors and cholangiocyte cholesterol transport.
Western blot analysis. Cells were rinsed with ice-cold PBS and resuspended in lysis buffer
(1% Triton X-100, 50 mM Tris-HCl, pH 7.4, 150 mM NaCl) + protease inhibitor mixture (Roche). Cell
lysates (50 μg) were separated by 10% SDS-PAGE and blotted onto a nitrocellulose membrane. The
membrane was incubated for 1 hr at room temperature in Tris-buffered saline/Tween 20 (20 mM TrisHCl, pH 7.4, 150 mM NaCl, 0.05% Tween 20) with 5% nonfat milk. The membrane was incubated with
ABCA1, PPARδ, LXRβ and NPC1L1 polyclonal for 1hour in Tris-buffered/Tween 20. The detection
system was horseradish peroxidase-conjugated secondary anti-rabbit antibody (Amersham). Specific
binding was visualized by the enhanced chemiluminescence detection system (ECL) (GE Healthcare)
according to the manufacturer's instructions.
Cholesterol Efflux and uptake. For cholesterol efflux, NRC were cultured on transwell inserts
(Costar,Cambridge, MA) until confluence and incubated with 0.5 μCi/ml [3H]-cholesterol (Amersham,
Piscataway, NJ) and 50 μg/ml cholesterol for 24h in serum free medium (SFM) containing 0.2% BSA.
Cells were washed twice with PBS/0.2% BSA and once with SFM/0.2% BSA and subsequently incubated
for 24 hours in SFM/0.2% BSA containing T0901317, GW501516. During the last 4 hours, 10μg/ml
ApoAI was added to apical and basolateral compartments as an acceptor for excreted cholesterol. After
incubation, apical and basolateral medium were collected separately and centrifuged to remove cell debris,
and cells adherent to the insert were washed twice with ice-cold PBS and dissolved with TS-2 tissue
solubilizer (RPI). [3H]-cholesterol in the apical and basolateral medium and dissolved cells was
determined by liquid scintillation counting. Results are shown as percentage efflux (counts in apical or
basolateral media/total counts in cells and media from both compartments). For cholesterol uptake,
preparation of mixed micelles: stock solutions of taurocholate (ACROS ORGANICS, Morris Plains, NJ)
were prepared in methanol; egg yolk phosphatidylcholine (Sigma) and cholesterol (Sigma) were prepared
in chloroform and lyophilized. The lipid film was hydrated with taurocholate (9.7mM), egg yolk
3
Xia et al. Nuclear Receptors and cholangiocyte cholesterol transport.
phosphatidylcholine (6.5 mM) and cholesterol (1.5 mM) with 0.2 μCi/ml [3H] cholesterol in DMEM and
mixed micelles were added to apical compartment of cultured NRC. Cells were lysed in 0.1N NaOH, and
dissolved in scintillation fluid and counted with a β-counter.
EMSA. Nuclear extracts were prepared from PPARδ expressing AAV293 cells using a Nuclear/Cytosol
Fractionation Kit according to manufacturer’s instruction (BioVision, Mountain View, CA). Doublestranded oligonucleotides were synthesized corresponding to murine NPC1L1 promoter nucleotides –142
to -115 containing the putative PPARδ binding site: sense strand: wild-type, 5'TCCTATTGGCCCCATGACAGACGAGGGT -3'. A similar mutated version was also prepared
containing nucleotide substitutions in Figure.5B. Double-stranded oligonucleotides were end-labeled with
[γ-32P] ATP (3,000 Ci/mmol) using T4 polynucleotide kinase. Nuclear extract proteins (20 µg) were added
to binding buffer [10 mM Tris, pH 7.5, 50 mM NaCl, 0.1 mM EDTA, 1 mM dithiothreitol, 4% glycerol,
and 1 µg poly (dI-dC)] at 4°C for 1 h. Binding reactions were performed for 10 min at room temperature.
For competition assays, 20-, 50-, 100-fold molar excess of unlabeled wild-type, mutant or nonspecific
competitor oligonucleotide was used. DNA-protein complexes were resolved on 6% native
polyacrylamide gels in 0.5X Tris borate-EDTA buffer. The gels were dried and exposed to X-Ray film to
detect DNA-protein complexes.
ChIP coupled RT-qPCR. ChIP was performed using Chromatin Immunoprecipitation Assay Kit
(Millipore, Billerica, MA) according to the manufacturer’s protocol with the following modifications: 1))
to increase the specificity, the protein A agarose/antibody/protein complex was washed an additional two
times with our modified cell lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1 mM EDTA, pH8.0, 1%
Triton X-100, 0.1% SDS, and a cocktail of protease inhibitors); 2) to prevent loss of the beads, all
incubations, washes and bead collections were carried out on ice using Poly-prep chromatography
columns or Bio-spin disposable chromatography columns (Bio RAD) and 3) the eluted DNA from the
4
Xia et al. Nuclear Receptors and cholangiocyte cholesterol transport.
washed agarose/antibody/protein complex with elution buffer (1% SDS, 0.1M NaHCO3) was reverse
cross-linked and purified with a PCR Purification Kit (Qiagen) rather than by phenol/chloroform
extraction as proposed by the manufacturer. Relative abundance of FLAG-PPARδ was calculated by
measuring the apparent immunoprecipitation efficiency (the ratio of the copy number of the ChIP sample
to that of the corresponding input). The average and standard error of each sample were calculated from
the triplicates, followed by Unpaired Student’s t-test with significance set at P < 0.05.
determine statistical significance.
Legends
Fig. S1: NRs gene expression in cholangiocytes. 10μg total RNA was isolated from liver and normal rat
cholangiocytes (NRC) and used in Northern blotting with indicated 32P-labeled cDNA probes or RT-PCR,
respectively. L, liver; C, cholangiocytes.
Fig. S2: Lipid metabolic gene expression in cholangiocytes. 10μg total RNA was isolated from liver and
normal rat cholangiocytes (NRC) and used in RT-PCR. L, liver; C, cholangiocytes.
Fig. S3-S6: NRs and lipid metabolic gene expression levels were determined by real-time qPCR in
isolated rat hepatocytes (Hep), large cholangiocytes (LC), and small cholangiocytes (SC). Data presented
as means of three assays performed in duplicate ± SD and normalized to cyclophilin. *Significant
differences by Student's t-test (* P< 0.05, ** P<0.01 versus hepatocytes).
5