Drosophila growth-blocking peptide-like factor mediates acute immune reactions
during infectious and non-infectious stress
Seiji Tsuzuki1, Masanori Ochiai2, Hitoshi Matsumoto1, Shoichiro Kurata3,
Atsushi Ohnishi4 and Yoichi Hayakawa1*
1
Department of Applied Biological Sciences, Saga University,
Honjo 1, Saga 840-8502, Japan, 2Institute of Low Temperature Science, Hokkaido
University, Sapporo 060-0819, Japan, 3Graduate School of Pharmaceutical Sciences,
Tohoku University, Sendai 980-8578, Japan, 4The Institute of Physical and Chemical
Research, Wako351-0198, Japan
Supplementary Information
Materials and Methods
Chemicals
- Peptides such as Bombyx GBP (paralytic peptide), Lucilia GBP, and
Drosophila GBPs were synthesized by the solid phase method using standard Fmoc
(N-(9-fluorenyl)methoxycarbonyl) chemistry. Synthesized peptides were suspended at a
concentration of 1 mg/ml in 10 mM Tris-HCl, pH8, and stored at 4oC for 15-20 h. After
checking disulfide bond formation by reversed-phase HPLC with a C18 column (250 x
4.6 mm, RP-18, Kanto Chemical Co.), the peptide samples were purified by HPLC with
a preparatory C18 column (250 x 10 mm, RP-18, Kanto Chemical Co.) as described
previously1. Peptides were solubilized in NaCl/Pi buffer (8 mM Na2HPO4, 1.5 mM
KH2PO4, 137 mM NaCl, and 2.7 mM KCl, pH 7.2) when used in bioassay.
Preparation of Hemolymph
- The bluebottle fly hemolymph (approximately 0.7
ml) was collected in an ice cold microtube containing 0.7 ml of 50% acetone with 5 mM
(p-amidinophenyl) methanesulfonyl fluoride hydrochloride (Wako, Japan) by cutting the
anterior tip of the larvae. After centrifugation at 4oC for 10 min at 20,000 g, the
supernatant was concentrated by lyophilization and the concentrated supernatant was
used for further purification.
Hemocyte Collection and in Vitro Bioassay
-
Hemolymph was collected from
full-grown last instar larvae into anticoagulant solution (98 mM NaOH, 186 mM NaCl,
17mM Na2EDTA and 41 mM citric acid, pH 4.5) as described previously2. After a
1
30-min incubation on ice, hemocytes were collected by centrifugation at 4oC for 1 min at
300 g. The collected hemocytes were washed twice in Ex-cell 405 medium by
sedimentation and resuspension. The ability of each fraction to induce hemocyte
aggregation was assayed using 96-well culture plates (BM Equipment Co.). Plates were
prepared by first adding 5 µl of the indicated sample solution to each well. Wells were
then filled with 45 µl of the medium containing 1 x 104 hemocytes. Hemocytes were
monitored by phase-contrast microscopy using an Olympus inverted microscope IX70.
The activity was quantified by end-point dilution using the hemocyte aggregation assay.
Bioassays with each sample were always paired with assays of bovine serum albumin
(BSA) to control any variation in aggregation response that might exist between
hemocyte samples2.
Measurement of antibacterial activity of Bombyx mori larval hemolymph
-
Antibacterial activity was assayed by agar well diffusion method using Serratia
marcescens. Wells of 5 mm diameter were punched in LB agar plates seeded with E.
cloacae and the plates were then incubated at 37°C for 24 h. The diameter of a zone of
clearing in the turbid agar around each well containing test hemolymph samples was
measured to obtain a semi quantitative determination of the concentration of the
antibacterial compound.
Peptide Purification
- The concentrated hemolymph sample was filtered through a
membrane with an exclusion limit, 5,000 nominal molecular weight (Ultrafree-MC,
Millipore Co.), and the filtrate was chromatographed by a C18 HPLC column (150 x 4.6
mm, UG120, Shiseido Co.) with a linear gradient of 0 - 50% CH3CN in 0.05%
trifluoroacetic acid at a flow rate of 0.5 ml/min. The desired fraction was collected and
further resolved by a C4 HPLC column (250 x 4.6 mm, YMC Co.) with a gradient of 10 40% CH3CN in 0.05% trifluoroacetic acid at a flow rate of 0.5 ml/min. Further
purification was performed by a cyanopropyl-derived silica HPLC column (250 x 4.6 mm,
UG120, Shiseido Co.) with a gradient of 10 - 40% CH3CN in 0.05% trifluoroacetic acid
at a flow rate of 0.5 ml/min. The active fraction was resolved by a C 18 column (250 x 4.6
mm, RP-18, Kanto Chemical Co.) with a gradient of 15 - 40% CH3CN in 0.05%
trifluoroacetic acid at a flow rate of 0.5 ml/min. Further, the active fraction was
rechromatographed by the two tandem connected C18 columns (C18 - C18 column) (500 x
4.6 mm, RP-18(H), Kanto Chemical Co.) with a gradient of 15 - 30% CH3CN in 0.05%
trifluoroacetic acid at a flow rate of 0.3 ml/min. The active fraction was finally purified to
2
homogeneity by the same column with a linear gradient of 18 - 28% CH3CN in 0.05%
trifluoroacetic acid at a flow rate of 0.3 ml/min. The purified peptide was
carboxymethylated and purified for sequencing.
The carboxymethylated peptide was analyzed by automated Edman degradation
with a protein sequencer (PPSQ 21, Shimadzu). The sequence was verified by analyzing
approximately 100 pmol of the purified peptide twice. The sequenced peptide was
synthesized by the solid phase method and their biological activities such as hemocyte
aggregation and cell growth were tested.
cDNA Synthesis and Cloning
- Total RNA was extracted from the bluebottle fly
larval fat body using TRIzol (Gibco-BRL) according to the manufacturer’s protocol. For
cDNA syntheses, polyadenylated mRNAs were purified from total RNA using the
QuickPrep mRNA purification kit (GE Healthcare). A cDNA fragment encoding the
bluebottle fly cytokine was amplified by PCR using the following degenerate primers
designed from the determined peptide sequence: GCNCCNTCNAAYTGYC and
RCANCKNCCYTTRAA. Afterwards, by repeating 5’- and 3’-RACE methods, a cDNA
fragment containing an entire ORF of the bluebottle fly cytokine was sequenced
(AB243069).
RT-PCR Analysis
-
To determine whether the Drosophila melanogaster genes are
expressed in each species of larvae, RT-PCR was conducted essentially according to the
procedure described previously3. First-strand cDNA was synthesized with oligo(dT)12-18
primer using ReverTra Ace RT-PCR kit (Toyobo) according to the manufacturer’s
protocol. PCR amplification was performed with the following primers using a profile as
follows: 35 cycles of 30 sec at 95oC, 1min at 55oC and 1.5 min at 72oC.
For CG11395: TTTGCAGCCTCGACCCGG and GGCTTCCTTCCTGCAACG,
for
CG12517:
ATGAGTAACCTGGGATCAATAC
and
ATGAACACAGCGACCACAATTG
and
ACTTGTGTCCAGCAGAATTTC,
for
CG14069:
GAATCTCGAGTAGCATTTCACC,
for CG15917: ATGTTGATACGTATTAATCCATTG and TTACGCCGGCTTTCTGCATC,
for CG17244: CCAGTCCCGTTCAGCCCA and CCCGACAGCGACCACGAT.
PCR analysis of CG15917 gene expression in the transgenic fly was performed with
the above primers using a modified profile as follows: 25 cycles of 30 sec at 95oC, 1 min
at 55oC and 1 min at 72oC.
3
Real-time quantitative PCR analysis of AMP gene expression in B. mori and D.
melanogaster larvae was carried out by using the Light-Cycler 1.3 instrument and
software (Roche Applied Science) as described previously3. PCR specificity was
confirmed by the molecular masses of the PCR products and melting curve analysis at
each data point. The copy numbers of RNA coding the genes of interest were
standardized against that of the RNA coding rp49 in each sample. Specific primer pairs
of Drosophila AMPs are described previously4 and those of Bombyx AMPs are as
follows.
Alpha-tubulin:
ACTAACTTGGTGCCTTACCC
and
ACTAACTTGGTGCCTTACCC,
Cecropin-A: CCGAGCACTATAGAATTTCGG and TCGCTTGCCCTATGACGGCTA,
Moricin-1:
GCAAAAACAGTAAACCGCGCAG
and
AAACATCGTTGGCTGTACTGG,
Attacin: CAGACAAGTAATACGACACAGG and ATGGCGCTGAGCACGTTCTTGT,
Gloverin-1:
ACGCAGAAGTTTACGGACCTTC
and
TGCCGCGGTCGTCATTAAAGAT.
Drosophila eggs were collected for 10-12 h at 25oC from test female flies and, three
or four days after collecting eggs, 5 third instar larvae were randomly selected and used
for measurement of AMP expression levels in each experiments. AMP expression levels
in test larvae were measured within 3 h after GBP overexpression by heat treatment. We
further confirmed no significant difference in Mtk and Dpt expression levels between
day 3 and day 4 larvae. Therefore, under these experimental conditions, the
GBP-induced delay in larval development could not affect AMP expression levels.
References
1. Ohnishi, A., Oda, Y. & Hayakawa, Y. Characterization of receptors of insect cytokine,
growth-blocking peptide, in human keratinocyte and insect Sf9 cells. J. Biol. Chem.
41, 37974-37979 (2001).
2. Aizawa, T. et al. Structure and activity of the insect cytokine growth-blocking
peptide. J. Biol. Chem. 276, 31813-31818(2001).
3. Ninomiya, Y. et al. Insect cytokine growth-blocking peptide signaling cascades
regulate two separate groups of target genes. FEBS J. 275, 894-902(2008).
4.
Takehana,
A.
et
al.
Overexpression
of
a
pattern-recognition
receptor,
peptidoglycan-recognition protein-LE, activates imd/relish-mediated antibacterial
4
defense and the prophenoloxidase cascade in Drosophila larvae. Proc. Natl Acad. Sci. USA
99, 13705-13710 (2002).
5. Levashina, E.A., Ohresser, S., Lemaitre, B. & Imler, J.L. Two distinct pathways can
control expression of the gene encoding the Drosophila antimicrobial peptide
metchnikowin. J. Mol. Biol. 278, 515-527 (1998).
5
Fig. 1
-
Purification of Lucilia GBP from the Lucilia larval hemolymph
Six analytical HPLC runs using reverse phase columns monitored at 220 nm in combination
with hemocyte aggregation assays resulted in isolation of an active peptide.
A, C18 active fraction is indicated by horizontal bar.
B, C4 active fraction is indicated by horizontal bar.
C, Cyanopropyl active fraction is indicated by horizontal bar.
D, C18 active fraction is indicated by horizontal bar.
E, C18-C18 active fraction is indicated by horizontal bar.
F, C18-C18 active fractions is indicated by horizontal bar.
6
Fig. 2
-
A 554 bp cDNA encodes Lucilia GBP homolog
Nucleotide sequence of Lucilia pre-pro-GBP is described with the deduced amino acid
sequence for the predicted protein shown below the corresponding codons. The
underlined and red-colored sequences indicate the putative signal peptide sequence and
active peptide sequence, respectively.
7
Fig. 3
- Sequence alignment of the GBP homolog genes
Amino acid sequence alignment of genes encoding GBP and the homologous peptides
identified in Lepidoptera (Pseudaletia separata, Mamestra brassicae, and Spodoptera
litura) and Diptera (Lucilia cuprina and Drosophila melanogaster). Red-colored
sequences at C-terminal ends indicate active GBPs (or putative active GBPs after
processing by a serine proteinase). Conserved cysteine residues are emphasized by
green bands. The number in parenthesis indicates the total number of amino acid
residues found in the open reading frame of each gene.
8
Fig. 4
- Timing of pupariation of third instar larvae of transgenic Drosophila
larvae
Same-staged larvae of control lines (hs-Gal4 and UAS-GBP) and GBP overexpression
line (hs-Gal4/UAS-GBP) were heated at 33oC for 30 min.
9
Fig. 5
- Expression of the GFP reporter gene in Mtk-GFP transgenic larvae
(a) Mtk-GFP transgenic larvae5 without any treatment. (b) Mtk-GFP transgenic larvae
treated at the heat treatment, 35oC for 30 min. (c) Expression of the Mtk-GFP reporter
in transgenic larvae (UAS-proGBP/+; hs-GAL4/ Mtk-GFP) by the forced expression of
proGBP under the direction of an hs-Gal4 driver after the heat treatment. (d) Expression
of the reporter in the larvae stabbed with a needle previously dipped in 100 µM dGBP.
(e) Expression of the reporter in the larvae stabbed with a sterile needle. (f) Expression
of the reporter in the larvae stabbed with a needle coated with Gram-negative bacteria
(Serratia marcescens). GFP expression was recorded at 6 hr after the heat treatment for
proGBP overexpression or stabbing with a needle.
10
Fig. 6
- Effects of GBP overexpression driven by an actin-Gal4 driver on Mtk,
Dpt, and Drs expression in Drosophila adults
Metchnikowin (Mtk), Diptericin (Dpt), and Drosomycin (Drs) expression levels were
measured in Drosophila adults with overexpression of GBP under the direction of an
actin-Gal4 driver. Data are given as means + S.D. for three separate measurements.
Asterisks indicate significant differences from control UAS-GBP line (t-test; *P<0.05,
**P<0.01).
11
Fig. 7
- Reduction of Drosophila GBP expression in GBP RNAi larvae after heat
treatment
(a) RT-PCR was performed by using total RNAs prepared from whole bodies of GBP
RNAi larvae at indicated times after heat treatment. (b) Hemolymph peptide fraction
was prepared from GBP RNAi larvae at indicated times after heat treatment, and used
for Western blot analysis. Peptide fraction was prepared in the same way as hemolymph
peptides of the bluebottle fly larvae (see Materials and Methods). Note that 36 h after
heat treatment, no signal could be detected by anti-GBP antibody. (c) Fat bodies isolated
from control and GBP RNAi larvae 36 h after heat treatment. (d) Weight ratio of fat
body to the whole body (white bar) and protein concentration in fat body (gray bar) of
each test animal (control and GBP RNAi lines). Wet weight of fat body was measured
soon after absorption of excessive water. Data are given as means + S.D. for four
separate measurements. Note that these results including (c) and (d) indicate the
normality of fat body in GBP RNAi larvae.
12
Fig. 8
- Bacteria growth in GBP RNAi larvae after injection
GBP RNAi and control larvae were challenged with Gram-negative bacteria Serratia
marcescens and 1 µl of hemolymph was collected from each larvae 6 h after the bacterial
injection. The collected hemolymph was diluted serially and plated onto a LB agarose plate.
S. marcescens CFUs were determined by testing four groups of five larvae for each time
point. Data are given as means + S.D. for four separate measurements. *, P<0.05 versus
control by t-test.
13
Fig. 9
- Survival rate of GBP RNAi larvae after aseptic injury
Control (●) and GBP RNAi larvae (○) were stabbed with a sterile needle (diameter:
approximately 0.23 mm) and cultivated in a sterile tube containing autoclaved food. The
survival rates were measured at indicated times. Data are given as means + S.D. for
three separate measurements. Significant difference between control and test larval
slopes were determined using ANOVA with the general linear model procedures of
Minitab (release 14, Minitab Inc., USA).
14
Fig. 10
- GBP overexpression in bsk RNAi larvae
Bsk and GBP expression levels were measured by using total RNAs prepared from
control and test Drosophila larvae. Note that bsk expression was apparently repressed
but GBP was overexpressed in UAS-GBP/+;actin-Gal4/UAS-dsbsk larvae.
15
Fig. 11
-
GBP-dependent JNK phosphorylation in Drosophila larvae and S2
culture cells
(a) Western blot analysis of the phosphorylation of fat body JNK (p-JNK) in Drosophila
larvae with GBP overexpression. Note that phosphorylation levels of fat body JNK was
significantly increased 1 h and 2 h after heat treatment at 35oC for 30 min. BH: before
heat treatment; 0 h: immediately after heat treatment. (b) Western blot analysis of the
phosphorylation of JNK in
Drosophila S2 cells. Note that GBP-induced
phosphorylation of JNK was clearly observed in S2 cells 10 min after adding 100 nM
synthetic GBP into the culture medium.
16