Supplementary method
Human embryonic stem cell cultures:
The hESC lines, H1 and H9 1, were obtained from WiCell Research Institute (Madison,
WI). HESCs (passages 29-60) were grown on mouse embryonic fibroblasts (MEFs),
which were inactivated with irradiation (60 Gy) or mitomycin C (1 mg/ml), in hESC
medium containing DMEM/F12, 20% knockout serum replacement (KSR), 2 mM Lglutamine, 0.1 mM nonessential amino acid (all from Invitrogen), 0.1 mM mercaptoethanol (Sigma), and 4 ng/ml human FGF-2 (R&D Systems). The feeder-free
culture on Matrigel (BD Biosciences) with MEF-conditioned medium (CM) was
performed as described 2. MEF-CM was filtered through a 0.22 m sterile membrane
and stored at >–20oC. To maintain hESCs in a long-term undifferentiated status, hESCs
were cultured at ~500 hESC colonies per 100-mm dish at 37°C and 5% CO2. We found
that the plating density of MEFs had a significant effect on the differentiation of hESCs
into CD34+ cells. We identified the optimal MEFs plating density to be ~1x10 4 cells/cm2
on a gelatin-coated dish (5 to 6 x 105 cells/100-mm). MEFs were used up to passage 3
for hESC cultures. MEF conditioned medium (MEF-CM) with 4 ng/ml of human FGF-2
(hFGF-2, R&D Systems or PeproTech) was used on the first day of hESC passage.
MEF-CM and hESC medium (1:1) was used on the second day of hESC culture in the
presence of 4 ng/ml of hFGF-2. From the third day onward, the culture medium was
changed daily with hESC media.
Differentiation of hESCs:
To induce 3D embryoid bodies (EBs), the hESC colonies were treated with 2 mg/ml
dispase for 15 minutes at 37oC to loosen colonies and the colonies were transferred into
ultra low-attachment plates (Corning Incorporated) for EB formation. EBs were
differentiated in hESC differentiation medium consisting of IMDM, 15% defined-FBS
(Hyclone), 450 M monothioglycerol (Sigma), 2 mM L-glutamine, 50 U/ml penicillin, 50
g/ml streptomycin, and 0.1 mM non-essential amino acid for 10 days with half of the
medium changed every 2-3 days.
1
For 2D monolayer differentiation, undifferentiated hESCs were cultured at a higher
density (~1200 hESC colonies/100-mm dish) on MEFs for 7 days. At day 0 of
differentiation, the culture medium was changed to hESC differentiation medium and the
medium was changed every 2-3 days for 10 days. Three batches of defined-FBS from
Hyclone were tested (Lot# ARA25685, ARA25663, and AQL25247). Similar CD34 and
CD31 expression was obtained from these 3 batches of defined-FBS. For serum-free
differentiation, 15% defined-FBS in hESC differentiation medium was replaced with
either 20% BIT 9500 (StemCell Tech) or KSR, and supplemented with VEGF (50
ng/ml), bFGF (50 ng/ml), and BMP-4 (50 ng/ml).
Isolation of CD34+ progenitor cells:
A recent study demonstrated that hESCs differentiate into cells of hematopoietic and
endothelial lineage at ~ day 10 3. After 10 days of differentiation in either 2D or 3D
culture, the single-cell suspensions were made from differentiated hESCs by treatment
with 2 mg/ml collagenase B (Roche) for 10 minutes at 37oC. The cells were dissociated
by gentle pipetting, and passaged through 70 and 40 m cell strainers (BD
Biosciences). To minimize the loss of cells, the strainers were rinsed extensively with
PBS/1%FBS or an additional strainer was used. CD34+ cells were isolated from
differentiated hESCs by using MACS MicroBeads columns or AutoMACS (Miltenyi
Biotec), according to the manufacturer’s instructions. PBS/0.5% BSA (without EDTA)
was used as the buffer for cell isolation. In some experiments, a Dead Cell Removal Kit
(Miltenyi Biotec) was used to remove dead cells prior to CD34 isolation. AutoMACS was
able to give higher number of CD34+cells than manual-selection. As determined by flow
cytometry, the purity of isolated CD34+ cells was generally 60-80% at a single column,
and > 95% after the second column.
Endothelial and hematopoietic differentiation:
For expansion and differentiation of endothelial cells, isolated CD34+ cells were seeded
on gelatin-coated wells (1.5 to 2x104 cells/cm2) in EGM-2MV medium (Cambrex).The
majority of cells (~65%) were adherent. The adherent cells reached to ~90% confluence
after 7-10 day culture. We found that the attachment of CD34+ cells was greater on
2
collagen I-coated wells (BD labware) than on gelatin-coated wells. However, gelatin has
the advantage of being considerable less expensive than collagen I-coated wells. In
some experiments, the CD34+ cells were cultured in hESC differentiation medium
containing the endothelial growth factors, hVEGF165 (50ng/ml) and FGF-2 (5 ng/ml
)(R&D Systems or PeproTech). After 7-10 days of incubation, the adherent cells were
harvested by trypsin-treatment and used for analyses. We noticed that the hES-ECs
have low proliferative capacity. Longer culture could result in the outgrowth of other cell
types besides endothelial cells.
For further expansion and differentiation of hematopoietic cells, isolated CD34+ cells
were cultured in 24-well plates (4 to 5 x104 cells/well in 0.5 ml) in hESC differentiation
medium containing 15% defined-FBS (Hyclone), 450 M monothioglycerol (Sigma), 2
mM L-glutamine, 50 U/ml penicillin, 50 g/ml streptomycin, and 0.1 mM non-essential
amino acid, and in the presence or absence of SCF (100 ng/ml) and Flt-3 ligand (100
ng/ml). In some experiments, the CD34+ cells were cultured in EGM-2MV in the
presence of SCF (100 ng/ml) and Flt-3 ligand (100 ng/ml). After 2 to 3 weeks of culture,
the suspension cells were analyzed.
Flow cytometry and immunostaining:
The cells were prepared in PBS containing1% FBS or 0.5% BSA, and were labeled for
15-30 minutes at 4oC with a combination of monoclonal antibodies (mAbs): CD31-PE
(clone WM-59), CD34-APC (clone 581), CD45-FITC CD45-FITC (clone HI30) (all from
BD PharMingen), and KDR-PE (clone 89106) (R&D system). We noticed that the
titrations of the specific antibodies have consequence on FACS results. In general, we
used 1:50 dilution for specific antibodies, and 1:200 for IgG control. The samples were
analyzed by a FACSCalisbur (Becton Dickson). Data analyses were performed using
CellQuest and FlowJo software.
For immunostaining, the cells were fixed with methanol for 5 minutes at -20oC or with
4% paraformaldehyde in PBS at room temperature for 15 minutes. The fixed cells were
incubated with 4% goat serum for 30 minutes to block nonspecific binding, and stained
for 1 hour with the primary antibodies: SSEA-1, SSEA-4, TRA-1-60, and TRA-1-81 (all
from Chemicon International Inc), CD31 (Dako), and VE-cadherin (BD Pharmingen),
3
respectively. The cells were then incubated for 30 minutes with either FITC-conjugated
rat anti-mouse secondary antibody (BD PharMingen) or Cy3-conjugated donkey antimouse secondary antibody (Jackson ImmunoResearch Laboratories).
For the LDL uptake assay, the cells were incubated with 10 ug/ml of diI-acetylated
low-density lipoprotein (Dil-LDL, Molecular Probes) for at least 4 hours. After washing
twice with PBS, the cells were examined under a fluorescence microscope.
Matrigel assay:
The assay performed essentially as previously described 4, 5. Twenty four-well plates
were coated with 200 μl/well Matrigel matrix (BD Biosciences) at room temperature for
more than 30 minutes. The hESC-derived endothelial cells (5 x 104 cells) were
trypsinized and replated onto Matrigel plates in differentiation medium at 37C in 5%
CO2. The structures were photographed under phase-contrast microscope (Nikon) after
16 hours of incubation.
Tissue engineered blood vessels:
To generate hES cell-derived endothelial cells, human ES cell-derived CD34+ cells
were cultured in either EGM-2 medium or differentiation medium with 50 ng/ml rhVEGF
and 5 ng/ml rhFGF-2 for 7 to 10 days. One million endothelial cells and 2x10 5 10T1/2
cells were suspended in 1 ml solution of rat-tail type 1 collagen (1.5 mg/ml) (BD
Biosciences, Bedford, MA) and human plasma fibronectin (90 mg/ml) (Sigma) in 25 mM
Hepes (Sigma) buffered EGM medium at 4°C. The pH was adjusted to 7.4 by using 1N
NaOH (Fisher Science, NJ). The cell suspension was pipetted into 12-well plates
(Falcon) and warmed to 37°C for 30 minutes to allow polymerization of collagen. Each
solidified gel construct was covered by one ml of warmed EGM medium. After one day
of culture in 5% CO2, a skin puncher was applied to create circular disk-shape pieces of
the construct (4-mm diameter), and they were implanted into the cranial windows in
SCID mice 6, 7. Multiphoton laser-scanning microscopy was used to visualize and
quantify the morphological changes of EGFP-expressing hESC-derived endothelial
cells. The perfused vessels were highlighted by tail vein injection of 1%
4
tetramethylrhodamine-labeled dextran (MW 2000,000), indicating the formation of
functional engineered vessels 6, 7
RT-PCR analysis
Total RNAs were isolated using Trizol (Invitrogen). To eliminate DNA contamination, the
RNA samples were treated with DNase (Invitrogen) before the reverse transcription
(RT) reaction (SuperScript II RNase H- Reverse Transcriptase, Invitrogen). The
sequences of oligonucleotide primers used for PCR are listed.
Oct-4 (F) AGGGCAAGCGATCAAGCA
Oct-4 (R) GGAAAGGGACCGAGGAGTA
CD31 (F) CCCAGCCCAGGATTTCTTAT
CD31 (R) ACCGCAGGATCATTTGAGTT
GATA-2 (F) GACGACAACCACCACCTTATG
GATA-2 (R) GACTTAAAGGTGGGAGGTGTC
VE-cad (F) CAGCCCAAAGTGTGTGAGAA
VE-cad (R) TGTGATGTTGGCCGTGTTAT
CD34 (F) GCCATTCAGCAAGACAACAC
CD34 (R) AAGGGTTGGGCGTAAGAGAT
KDR (F) GGGAAAGCATCGAAGTCTCA
KDR (R) CGTCCTCCTTCCTCACTCTG
vWF (F) TCGGGCTTCACTTACGTTCT
vWF (R) CCTTCACTCGGACACACTCA
CD105 (F) GCCAGCATTGTCTCACTTCA
CD105 (R) GGCACACTTTGTCTGGATCA
Nanog (F) ACTAACATGAGTGTGGATCC
Nanog (R) TCATCTTCACACGTCTTCAG
-SMA (F) CTGTTCCAGCCATCCTTCAT
-SMA (R) CGGCTTCATCGTATTCCTGT
EphB4 (F) GCCCATCATCATGTCTGTTTCCA
EphB4 (R) CACCAACTACCGCCCTTTTCAC
ephrinB2 (F) TGAGTGGGTGCGTGGTAT
5
ephrinB2 (R) GGAGAGGTTGGGGTGATG
LYVE-1 (F) TGGAGATGGATTCGTGGTC
LYVE-1 (R) GGGCAGGTATTGTAGAGTAAGG
Flt-4 (F) AGTTTGTGGAGGGAAAGAATAAGA
Flt-4 (R) TGGACAGGTTGAGGCGGTA
CD133 (F) AGCACTCTATACCAAAGCGTCAA
CD133 (R) CTCCCATACTTCTTAGTTTCCTCAA
Tie-2 (F) AGACCAGCACGTTGATGTGA
Tie-2 (R) TGGGTTGCTTGACCCTATGT
1.
2.
3.
4.
5.
6.
7.
Thomson, J.A. et al. Embryonic stem cell lines derived from human blastocysts. Science
282, 1145-1147. (1998).
Xu, C. et al. Feeder-free growth of undifferentiated human embryonic stem cells. Nat
Biotechnol 19, 971-974. (2001).
Wang, L. et al. Endothelial and hematopoietic cell fate of human embryonic stem cells
originates from primitive endothelium with hemangioblastic properties. Immunity 21, 3141 (2004).
Albini, A. et al. Inhibition of angiogenesis and vascular tumor growth by interferonproducing cells: A gene therapy approach. Am J Pathol 156, 1381-1393 (2000).
Bompais, H. et al. Human endothelial cells derived from circulating progenitors display
specific functional properties compared with mature vessel wall endothelial cells. Blood
103, 2577-2584 (2004).
Koike, N. et al. Tissue engineering: creation of long-lasting blood vessels. Nature 428,
138-139 (2004).
Yuan, F. et al. Vascular permeability and microcirculation of gliomas and mammary
carcinomas transplanted in rat and mouse cranial windows. Cancer Res 54, 4564-4568
(1994).
6