HEP-11-1300
An anti-apoptotic role of SNX7 is required for liver development in zebrafish
Materials and Methods
Bioinformatics
The sequences of human SNX genes were used to BLAST the zebrafish sequence databases at
ZFIN (http://zfin.org/action/blast/blast) and cDNA or EST sequences for zebrafish SNX genes
were identified. For phylogenetic analysis, the full-length amino acid sequences of SNX proteins
were aligned and phylogenetic tree generated using the ClustalX program. Zebrafish SNX genes
were named according to the homology with their human counterparts.
Molecular cloning
Molecular cloning was performed according to standard protocols. cDNAs for zebrafish SNX
genes were either purchased from ATCC or cloned by RT-PCR method. DIG-labeled RNA probes
for in situ hybridization were prepared by in vitro transcription as described (40). For rescue
experiments, the full-length cDNAs encoding human SNX7 and c-FLIPs were cloned in the
pCS2+ vector and mRNAs were prepared using the mMESSAGE mMACHINE Kit (Ambion,
CA). All constructs were confirmed by DNA sequencing. Detailed information about the
constructs is available upon request.
Zebrafish maintenance, morpholino injection and in situ hybridization
Zebrafish and embryos are maintained and staged as previously described (40). Longfin and
MP760 lines were used in this study. Morpholino antisense oligonucleotides to SNX7 were
purchased from Gene-Tools (Corvallis, OR): MO1 (ACCAGTTGATGTTTGATTACCTTAC, 4
ng/embryo), MO2 (GTGTAGTCTGTCATGAAGGAGAACG, 2 ng/embryo). The standard
control morpholino (CCTCTTACCTCAGTTACAATTTATA, 4 ng/embryo) was used as the
injection control. Morpholinos were injected at 1-cell stage. For rescue experiments, embryos
were first injected with morpholino, 5-10 min later, embryos were injected second time with
mRNA (100 pg/embryo). Control and SNX7 morpholino treated embryos were fixed at the
indicated stages and whole-mount in situ hybridization was performed as described (40).
Whole-mount fluorescence immunostaining
Dehydrated embryos (in methanol) were gradually rehydrated with PBS and their yolks were
carefully removed using fine-tipped forceps under a stereomicroscope. Embryos were then
incubated in acetone for 7 min at -20℃, washed with PBST (1X PBS with 0.1% Tween-20) and
blocked in PBST/ 2% blocking reagent (Roche)/5% goat serum/1% DMSO at RT for 1 hr. For
cell proliferation assay, embryos were incubated in rabbit anti-phosphohistone H3 (Upstate
Biotech, 1:500 in 3% normal goat serum/PBS) overnight at 4℃, washed with PBST (4 times, 15
min each) and incubated in secondly antibody (Alexa Fluor®568 conjugated goat anti-rabbit IgG,
Molecular Probes, 1:200) for 2 hrs at RT. After several washes with PBST, embryos were
counterstained with DAPI (1 µg/ml in PBS, 5 min), then washed again with PBS and ready for
imaging. TUNEL assay was performed by using the In Situ Cell Death Detection Kit (TMR red,
Roche Diagnostics) according to the manufacturer’s protocol. Fluorescence images were taken
using the Leica TCS SP2 Spectral Confocal System and manipulated with Adobe Photoshop.
Real-time RT-PCR
Embryos were collected and dechorionated at 30 hpf and the total RNAs were extracted using the
RNAqueous®-4PCR Kit (Ambion, CA). Reverse-transcription was performed using the ReverTra
Ace (TOYOBO, Japan). The product (cDNA) was properly diluted and used as PCR template.
PCR reactions were performed with the SYBR®Premix Ex Taq™ Kit (TAKARA, Japan) on the
ABI7300 Real-Time PCR System. The reaction mix was initially denatured (95℃ for 1 min),
amplified (cycles of 95℃ for 5 sec, 60℃ for 31 sec), and finally dissociated (95℃ for 15 sec，
60℃ for 30 sec, and 95℃ for 15 sec). The sequences of primers used were listed in the
supplementary table. The relative gene expression level was determined by the delta delta Ct
method. β-actin was the internal control. We define the ∆Ct of a gene as [Ct in morphants - Ct in
control]. The relative expression of gene X equals 2-[∆Ct (gene X)-∆Ct (β-actin)].
Cell culture, siRNA treatment and FACS analysis
HepG2 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with
10% FBS (Gibco, CA). Hela cells were cultured in Minimun Essential Medium (MEM)
supplemented with 10% FBS, GlutaMax, MEM NEAA (Non Essential Amino Acid) and sodium
pyruvate (Gibco, CA). siRNAs to human SNX7 and a universal control siRNA were designed and
synthesized by Ribobio (Guangzhou, China). The target sequences were:
GCAGGAAGGCTTTACATAA (siSNX7-a) and GAATTTGACTCCAGTGAAT (siSNX7-b).
Cells were seeded in 24-well plate (50,000 cells/well) for 20 hrs then siRNAs (final concentration
of 10 nM) were transfected with the DharmaFECT Transfection Reagent according to the
manufacturer’s protocol (Thermo Fisher, MA). 48 hrs after transfection, cells were treated with
cycloheximide (Sigma, 10 µg/ml) for 4.5 hrs (Hela) or 12 hrs (HepG2). TNFα (R&D Systems,
MN, 50 ng/ml) plus cycloheximide were used as the positive control. Cells were harvested and
TUNEL assay was performed by using the In Situ Cell Death Detection Kit (TMR red, Roche
Diagnostics) according to the manufacturer’s protocol. Samples were then analyzed by
fluorescence-activated cell sorting (Calibur, BD) with an excitation wavelength of 488 nm and
detection wavelength in the range of 570-620nm.
Western blot
Cells were harvested in RIPA lysis buffer (Cell Signaling, MA) and SDS sample buffer (final
concentration of 63 mM Tris-HCl pH 6.8, 10% glycerol, 5% ß-mercaptoethanol, 3.5% sodium
dodecyl sulfate, protease inhibitor cocktail (Roche) and 0.01% bromophenol blue) was added
immediately. Fish embryos were harvested at the indicated stages and deyolked by passing the
embryos though the 200 μl eppendorf pipette tip for several times. SDS sample buffer was added
to the deyolked embryos and samples were ultrasonicated. Samples were then boiled for 5-10 min
to denature the proteins, cleared by centrifugation at 12,000 rpm for 5 min and the supernatants
separated by SDS-PAGE. Western blot was performed according to standard protocol. Images
were scanned and quantified by the ImageJ 1.42q software. The following antibodies were used:
Caspase-8 (1C12) mouse mAb (Cell Signaling, 1:1000 dilution), rabbit polyclonal Caspase-9
(human specific) antibody (Cell Signaling,1:1000 dilution), rabbit polyclonal FLIP antibody (Cell
Signaling,1:1000 dilution), rabbit polyclonal antibody to PARP (Cell Signaling, 1:1000 dilution)
and mouse monoclonal β-actin antibody (Sigma,1:10000 dilution).