1
Supplementary Materials and Methods.
Packaging of retroviral vector
The simplified retroviral vector SF71gp91 phox 1 was harvested from culture supernatants of transiently transfected Eco-Phoenix packaging cells using the Stratagene (San Diego, CA) V-pack sy stem. Virus titer was estimated at ≈1 x 10 6 infectious particles per ml supernatant, based on gp91 phox expression in transduced bone marrow (BM) cultures from X-CGD mice, which carry a null allele for gp91 phox 2 .
Retroviral transduction and sex-mismatched transplantation of X-CGD murine BM
Isolation and transduction of murine X-CGD BM was essentially as described 3-5 , except using vector supernatant and transduction on 24 µg/cm
2. fibronectin fragment CH-296 (Takara Shuzo, Otsu,
Japan) rather than on packaging cells 4,5 . During pre-stimulation and transduction, BM cells were cultured in Alpha Minimum Essential Medium (

MEM, GIBCO) 30% FBS (Hyclone), 100 u/mL of Human IL-6
(Amgen, Thousand Oaks, CA) and 100 ng/mL of murine SCF (Amgen). SF71gp91 phox -transduced BM was injected intravenously into two groups of recipients. One group was conditioned with 300 cGy and transplanted with 8  10 6 or 5  10 6 cells per recipient in the first and second experiments, respectively.
The second group was transplanted with 2  10 6 cells per recipient following lethal irradiation using a split dose of 1100 cGy in the first experiment or single dose of 950 cGy in the second experiment.
Analysis of neutrophil NADPH oxidase activity and flavocytochrome b
558
expression
NADPH oxidase activity in phorbol 12-myristate 13- acetate (PMA)-stimulated peripheral blood neutrophils was assayed using dihydrorhodamine 123 (DHR 123) (Molecular Probes, Eugene, OR) and flow cytometry using FACSCalibur with CELLQuest software.
6 Superoxide production was assayed by cytochrome c reduction in BM enriched for neutrophils by depletion of adherent cells.
2,4,5 Immunoblots of human neutrophil and murine BM neutrophil lysates 5,7 were probed with the CL5 mouse monoclonal antibody to human gp91 phox (kind gift of A. Jesaitis, Montana State University) and a rabbit polyclonal antibody that recognizes both human and murine p22 phox .
2,8

2
Ligation-mediated (LM)-PCR
The biotinylated primer for LM-PCR, performed using Tsp5091-digested DNA as described, was 5’-CTGGGGACCATCTGTTCTTGGCCTC-3’; the adapter sequence 5’-
9-11
GTAATACGACTCACTATAGGGCACTATAGGGCACGCGTGGT3’ 12 was attached by blunt end ligation to the 5’ end the genomic DNA. For exponential PCR the following primers were used: adapter primers
SLAP1: 5’-GTAATACGACTCACTATAGGGC or SL-AP2: 5’-ACTATAGGGCACGCGTGGT-3’ 12 and
A2RV: 5’ GCCCTTGATCTGAACTTCTC-3’ or A3RV: 5’-CCATGCCTTGCAAAATGGC-3’ 10 for the SFFV
LTR primer. To sequence LM-PCR products, PCR products were run on a 2.5% agarose gel and lanes were excised above the internal control band, and cloned into pCR-2.1 TOPO vector (Invitrogen,
Carlsbad CA). After colony isolation, the size of the PCR products were analyzed on a 1.5-2.0% agarose gel and products with distinct insert sizes were selected for sequencing.
REFERENCES:
1. Ott MG, Schmidt M, Schwarzwaelder K, et al. Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1-EVI1,
PRDM16 or SETBP1. Nat Med. 2006;12:401-409.
2. Pollock JD, Williams DA, Gifford MA, et al. Mouse model of X-linked chronic granulomatous disease, an inherited defect in phagocyte superoxide production. Nat Genet.
1995;9:202-209.
3. Sadat MA, Pech N, Saulnier S, et al. Long-term high-level reconstitution of NADPH oxidase activity in murine X-linked chronic granulomatous disease using a bicistronic vector expressing gp91phox and a Delta LNGFR cell surface marker. Hum Gene Ther. 2003;14:651-
666.
4. Dinauer MC, Li LL, Bjorgvinsdottir H, Ding C, Pech N. Long-term correction of phagocyte
NADPH oxidase activity by retroviral-mediated gene transfer in murine X-linked chronic granulomatous disease. Blood. 1999;94:914-922.
5. Bjorgvinsdottir H, Ding C, Pech N, Gifford MA, Li LL, Dinauer MC. Retroviral-mediated gene transfer of gp91phox into bone marrow cells rescues defect in host defense against
Aspergillus fumigatus in murine X-linked chronic granulomatous disease. Blood. 1997;89:41-48.
6. Barese C, Pech N, Dirscherl S, et al. Granulocyte colony-stimulating factor prior to nonmyeloablative irradiation decreases murine host hematopoietic stem cell function and increases engraftment of donor marrow cells. Stem Cells. 2007;25:1578-1585.
7. Zhen L, King AA, Xiao Y, Chanock SJ, Orkin SH, Dinauer MC. Gene targeting of X chromosome-linked chronic granulomatous disease locus in a human myeloid leukemia cell line and rescue by expression of recombinant gp91phox. Proc Natl Acad Sci U S A. 1993;90:9832-
9836.
8. Baniulis D, Burritt JB, Taylor RM, et al. Monoclonal antibody CL5 recognizes the amino terminal domain of human phagocyte flavocytochrome b558 large subunit, gp91phox. Eur J
Haematol. 2005;74:337-347.

3
9. Kustikova O, Fehse B, Modlich U, et al. Clonal dominance of hematopoietic stem cells triggered by retroviral gene marking. Science. 2005;308:1171-1174.
10. Modlich U, Kustikova OS, Schmidt M, et al. Leukemias following retroviral transfer of multidrug resistance 1 (MDR1) are driven by combinatorial insertional mutagenesis. Blood.
2005;105:4235-4246.
11. Schmidt M, Hoffmann G, Wissler M, et al. Detection and direct genomic sequencing of multiple rare unknown flanking DNA in highly complex samples. Hum Gene Ther. 2001;12:743-
749.
12. Laufs S, Gentner B, Nagy KZ, et al. Retroviral vector integration occurs in preferred genomic targets of human bone marrow-repopulating cells. Blood. 2003;101:2191-2198.