Supplementary Information
Gene targeting
Ercc1 knockout. In the first step of the double replacement gene targeting strategy,
the exon 3-5 region of the Ercc1 gene was replaced with an Hprt minigene, resulting
in inactivation of the Ercc1 allele. To construct the Ercc1 knockout vector
(Supplementary Information Figure 1b) a 9.3 kb fragment containing exons 1-7 of the
mouse Ercc1 gene was subcloned into the KpnI site of pBluescript II SK(+)
(Stratagene) to form plasmid pKpnI_9.3. Two internal BglII fragments, containing
exons 3-5, were then removed and the vector was religated at the BglII site to produce
Vector A (not shown). The Hprt minigene, for positive selection, was isolated from
vector pBT/PGK-HPRT (Magin et al., 1992), modified by the addition of BamHI
linkers and inserted, in the opposite transcriptional orientation to the target gene, into
the BglII site in Vector A to produce Vector B (not shown). Finally, a PGK-TK
cassette, for negative selection, was cloned into Vector B as a NotI/ClaI fragment.
The Ercc1 knockout vector was linearised with NotI prior to electroporation into the
Hprt-deficient ES cell line, HM-1 (Selfridge et al., 1992). 3x106 cells were
electroporated at 850 V, 3 uF (Gene Pulser, Bio-Rad) in 0.8 ml 1x HBS with 200 µg
targeting vector. Positive selection in HAT medium was started 24 hrs later and, after
a further 4 days, negative selection was added with gancyclovir. Surviving colonies
were
screened
for
targeting
events
by
PCR
with
primers
T7471
(5'
CAACTACTTGAAGTCAAAGTCTCCC; located just upstream of the 5'-flanking
KpnI
site
[Supplementary
Information
Figure
1c])
and
262W
(5'
AGCCTACCCTCTGGTAGATTGTCG; located in exon 9 of the Hprt marker [Moore
et al., 1995]) with the following cycling parameters: 94°C 1 min, 66°C 1 min and
72°C 1.5 min for 35 cycles. The resulting targeting-specific PCR fragment was 2.6 kb
in size. Eight out of 153 colonies surviving the positive-negative selection (Mansour
et al., 1988) gave a positive PCR signal for gene targeting. The structure of the
knockout locus was confirmed by Southern blotting for 7 of these clones (data not
shown). Three of the clones were microinjected into 3.5 day Balb/C blastocysts and
seven chimaeras were generated. One chimaera gave germline transmission of the
targeted allele.
Ercc1 floxing. In the second round of gene targeting the Hprt marker in the knockout
clone was replaced with the Ercc1 exon 3-5 region, flanked by loxP sites. To
construct the floxing vector (ploxP_Ercc1; Supplementary Information Figure 1d), the
BamHI fragment containing the Ercc1 exon 3-5 region was isolated from the starting
plasmid pKpn I_9.3 and inserted into the BglII site of plasmid pBT/loxP, which
contains two loxP sites with a BglII site between them, a ClaI site 5' of the loxP sites
and EcoRI, BamHI and NotI sites 3' of the loxP sites, to introduce flanking loxP sites
and form vector C (not shown). Vector C was then cut with ClaI/NotI and the floxed
exon 3-5 region was then ligated into the BglII site of Vector A, forming
ploxP_ERCC1. Cells from an Ercc1 knockout clone were electroporated, as described
above, with 200 µg of NotI-linearised floxing vector and grown without drug
selection for 6 days before plating into 90 mm dishes at a density of 1.5x106 in
medium supplemented with 5 µg/ml 6-thioguanine. Drug-resistant colonies were
picked 11 days later and screened for floxing events by PCR with primers 432E and
159M. The wild-type allele gave a 1.8 kb band and the floxed allele a 1.4 kb band,
due to the loss of a small BamHI/BglII fragment from intron 5 during vector
construction (Supplementary Information Figure 1e). Three from 100 6-thioguanineresistant colonies screened gave a positive PCR signal for gene targeting. Southern
analysis confirmed the structure of the floxed Ercc1 allele (data not shown). The
resulting 3 clones heterozygous for the floxed allele were used for blastocyst
injection, germline transmission was obtained from one chimaera and a new strain
homozygous for the Ercc1 floxed allele was established.
BrdU immunostaining
Mice were injected (i.p.) with a filter sterilized BrdU 2.0% solution (Sigma) at 0.1
mg/g body weight in PBS. 24 hours later mice were euthanased and ears were
removed and fixed in 4% neutral buffered formalin. Tissue samples were dehydrated
and paraffin embedded, and 5 micron sections were cut and placed on polylysine
slides which were incubated at 37oC overnight. Slides were then deparaffinized in
xylene 3 times for 5 mins. Rehydration was carried out in graded alcohols (100%,
70%, 50%). Endogenous peroxidase activity was quenched with 3% H2O2 followed
by 0.1%Tween/TBS rinse. Epitope was unmasked with 1N HCl at 60oC for 1 hour
followed by 0.1%Tween/TBS rinse. Nonspecific antibody binding was blocked with
pre-heated normal goat serum (Vector Laboratories)/TBS, 1:5. Excess blocking
solution was blotted, and samples were incubated 1 hr at room temperature with rat
anti-BrdU antibody (Immunologicals Direct) at 1:50 dilution, followed by
0.1%Tween/TBS rinse. Samples were incubated 30 min with 5 ml of biotinylated goat
anti-rat antiserum (Immunologicals Direct) at 1:50 dilution and washed in
0.1%Tween/TBS. Diaminobenzamide staining used StreptABComplex/Horseradish
Peroxidase (DAKO) for 30 min and diaminobenzidine (DAB) reagents (Vector
Laboratories) for 7 mins. Samples were counterstained with haematoxylin, dehydrated
through ethanol, xylene-cleared, and mounted with Depex mounting medium (Sigma).
Supplementary Information Figure Legends
Figure 1 Construction of the Ercc1 floxed allele. (a) The structure of the wild-type
Ercc1 locus from strain 129/Ola mice is shown schematically. Exons are numbered
and shown as open boxes. Restriction sites are indicated. A polymorphic EcoRI site,
present in some of our stocks, but not strain 129/Ola-derived, is marked with an
asterisk. The primers and PCR product that distinguish the wild-type from the floxed
allele are indicated. (b) Ercc1 knockout vector. The Hprt marker is in the opposite
transcriptional orientation to the target locus. Stippled box, PGK promoter; diagonal
striped box, Hprt 3' UTR; shaded box, PGK-TK 3' UTR; thin lines, vector sequence.
(c) Ercc1 knockout locus. The primers and PCR product diagnostic for the knockout
locus are indicated. (d) Ercc1 floxing vector. Open triangles represent loxP sites. (e)
Ercc1 floxed locus. The primers and PCR product that distinguish the wild-type from
the floxed allele are indicated.
Figure 2 Liver phenotype in Ercc1flox/- mice with K5Cre mothers. Haematoxylin and
eosin-stained liver sections from 3-week old wild-type, Ercc1 null and Ercc1flox/- mice
with K5Cre mothers. Normal size hepatocyte nuclei are indicated (arrows) in the wild
type, while enlarged nuclei are indicated in both the null and the Ercc1flox/- mouse
with a K5Cre mother.