Microsatellite analysis of cloned wolves
advertisement
List of supplementary information 1. Supplementary Table 1. Sample IDs and DNA sources of animals 2. Supplementary Table 2. Primer sequence of 2005 Canine ISAG markers 3. Supplementary Table 3. Primer sequences of canine mitochondrion D-loop and D-loop adjacent region 4. Materials and methods 5. Supplementary Fig. 1. Chromatograms of microsatellite genotyping 6. mtDNA sequencing data; AB files and alignment file (DNASTAR®) - Download additional sequencing data file (mt_seq_abi and DNASTAR file.zip) Supplementary Table 1. Sample IDs and DNA sources of animals DNA Source Animal DNA Blood/Tissue Hair follicle Nuclear donor(wolf) D1 B1 F1 SNUWOLF D2 B2 . SNUWOLFY D3 B3 . Surrogate mother of SNUWOLF D4 B4 . Surrogate mother of SNUWOLFY D5 B5 . Oocyte donor of SNUWOLFY D6 T1 . Beagle 1 BG1 Beagle 2 BG2 Beagle 3 BG3 Supplementary Table 2. Primer sequence of 2005 Canine ISAG markers Locus Chromosome Dye Size range Forward sequence (5′–3′) Reverse sequence (5′–3′) AHTk253 CFA23 FAM 277-297 acatttgtgggcattggggctg tgcacatggaggacaagcacgc AHT121 CFA13 FAM 68-118 tattgcgaatgtcactgctt atagatacactctctctccg FH2054 CFA12 NED 135-179 gccttattcattgcagttaggg atgctgagttttgaactttccc INRA21 CFA21 PET 87-111 atgtagttgagatttctcctacg taatggctgatttatttggtgg AHTk211 CFA26 VIC 83-101 ttagcagccgagaaatacgc attcgcccgactttggca REN54P11 CFA18 FAM 224-242 gggggaattaacaaagcctgag tgcaaattctgagccccactg REN162C04 CFA07 PET 192-212 ttccctttgctttagtaggttttg tggctgtattctttggcaca AHTh171 CFA06 VIC 215-239 aggtgcagagcactcactca cccatccacagttcagcttt REN105L03 CFA11 FAM 231-249 ggaatcaaaagctggctctct gagattgctgccctttttacc AHTH130 CFA36 NED 111-141 gtttctctcccttcgggttc gacgtgtgttcacgccag REN169O18 CFA29 NED 154-170 cacccaacctgtctgttcct actgtgtgagccaatccctt Amelogenin CFAX NED 182-217 gtgccagctcagcagcccgtggt tcggaggcagaggtggctgtggc REN64E19 CFA34 PET 139-155 tgtattttaatgtggcagttt gacaaggacaggcaatacagt REN169D01 CFA14 PET 199-221 agtgggttgcaagtggaac aatagcacatcttccccacg FH2848 CFA02 VIC 228-244 caaaaccaacccattcactc gtcacaaggacttttctcctg AHT137 CFA11 VIC 126-156 tacagagctcttaactgggtcc ccttgcaaagtgtcattgct REN247M23 CFA15 VIC 268-282 tggtaacaccaaggctttcc tgtcttttccatggtggtga INU005 CFA33 FAM 104-136 ctttctaccagcaaggttac ttcccatttaattgcctct INU030 CFA12 FAM 143-157 ggctccatgctcaagtctgt cattgaaagggaatgctggt INU055 CFA10 FAM 204-220 ccaggcgtccctatccatct gcaccactttgggctccttc Supplementary Table 3. Primer sequences of canine mitochondrion D-loop and D-loop adjacent region Primer Gene specificity Region Forward Sequence (5′–3′) Reverse Sequence (5′–3′) D1p Cytochrome b 14,796-15,422 gatccaacaacccttcagga gatggtggagcaagagcttc D2p D-loop 15,232-15,919 atcggacaagtcgcttcaat accaaatgcatgacaccaca D3p D-loop 15,838-16,497 attctcgcaaatgggacatc atgacatgagtttacggggg D4p D-loop, 12s rRNA patial 16,435-16,727 /1-280 gcgcgcaagacattaagtt gtttgggttaatcgtatgaccg MATERIALS AND METHODS Microsatellite analysis of cloned wolves Microsatellite analysis was performed on a nuclear donor wolf, wolves produced by SCNT, two surrogate mothers and an oocyte donor dog. The DNA from blood and tissue were extracted by the standard proteinase K/phenol-chloroform procedure. The 16 genomic DNA samples were used for microsatellite assay using twenty 2005 Canine ISAG markers (AHTk253, AHT121, FH2054 , INRA21, AHTk211, REN54P11, REN162C04, AHTH171, REN105L03 , AHTH130, REN169O18, Amelogenin, REN64E19, REN169D01, FH2848, AHT137, REN247M23, INU005, INU030 and INU055) labeled with one of the fluorescent dyes FAM, NED, PET or VIC (Table 1). PCR products were generated in 10 µl reactions containing 20 ng DNA, 125 µM dNTPs, 1.25 pmol each of the respective forward and reverse primers (forward primers were fluorescently labeled), and 0.15 U Taq DNA polymerase (Applied Biosystems, Foster city, CA). Amplification was carried out in a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems) under touch-down conditions. PCR products were resolved with an internal size standard (GeneScan 500 LIZ, Applied Biosystems).Genotyping was performed by electrophoresis on an automated DNA sequencer (ABI 3100; Applied Biosystems), and genotype data was analyzed by means of GeneScan and Genotyper software (Applied Biosystems). Sequencing analysis of the canine mitochondrion D-loop region We have sequenced canine mitochondrion D-loop, about 2 kb including the D-loop adjacent region. Four primer sets for the amplification and sequencing analysis were designed based on GenBank sequences (Ref. Genome seq.; NC_002008 (U96639) released on 12. Jan. 2004). PCR primer sequences are listed in supplementary Table 3. PCRs were performed in a mixture of 1.25 pmol of each primer, 30 ng genomic DNA, 250 µM dNTPs, and 0.15U Taq DNA polymerase (Applied Biosystems) in the buffer provided by the manufacturer. Amplification was carried out in a GeneAmp PCR System 9700 thermal cycler (Applied Biosystems) under touch-down conditions. Nucleotide sequencing was performed using the Big Dye Terminator version 3.1 Cycle Sequencing kit (Applied Biosystems) and an ABI 3730 Genetic Analyzer (Applied Biosystems). Sequence variants were verified by chromatograms using the software, DNASTAR®. Supplementary Fig. 1. Chromatograms of microsatellite genotyping For sample ID, please see supplementary Table 1. A. P01_AHTk253, B. P02_AHT121, C. P03_FH2054, D. P05_INRA21, E. P06_AHTk211, F. P07_REN54P11, G. P08_REN162C04, H. P10_AHTh171, P14_Amelogenin, I. P11_REN105L03, M. P15_REN64E19, J. P12_AHTH130, N. K. P16_REN169D01, P13_REN169O18, L. O. P. P17_FH2848, P18_AHT137, Q. P19_REN247M23, R. P20_INU005, S. P21_INU030, T. P22_INU055 E. P06_AHTk211 B1 B2 B3 B4 B5 D1 D2 D3 D4 D5 D6 F1 T1 BG1 BG2 BG3 F. P07_REN54P11 G. P08_REN162C04 H. P10_AHTh171 I. P11_REN105L03 B1 B2 B3 B4 B5 D1 D2 D3 D4 D5 D6 F1 T1 BG1 BG2 BG3 J. P12_AHTH130 K. P13_REN169O18 L. P14_Amelogenin M. P15_REN64E19 B1 B2 B3 B4 B5 D1 D2 D3 D4 D5 D6 F1 T1 BG1 BG2 BG3 N. P16_REN169D01 O. P17_FH2848 P. P18_AHT137 Q. P19_REN247M23 B1 B2 B3 B4 B5 D1 D2 D3 D4 D5 D6 F1 T1 BG1 BG2 BG3 R. P20_INU005 S. P21_INU030 T. P22_INU055
