Supplementary material Schoen et al.
1
Supplementary material
Construction of plasmid vectors and L. monocytogenes carrier strains.
All cloning procedures were carried out according to standard protocols (Sambrook and Russell, 2000). Listeria
monocytogenes strains WL-140 and WL-142, respectively, containing plasmid pSP118-EGFP (strains S1 and
S70, respectively) are described elsewhere (Pilgrim et al., 2003). Strain S21 was obtained after introduction of
plasmid pSP118 into strain WL-140 by electroporation, strain DL-2 analogously after introduction of plasmid
pSP118-ovacyt (D. Löffler).
Derivatives of pSP0 and pSP118. For the generation of PolT7-encoding plasmids, a 2.7 kb fragment
containing the polT7 gene was amplified from plasmid pPOLT7 (Conrad et al., 1996) via PCR using proof
reading Pfu polymerase (Stratagene, Heidelberg, Germany) and primer pair POLT7-1 (see Table 1 for primer
nucleotide sequences) and POLT7-3(NotIPstI). A 250 bp fragment upstream of the actA gene coding sequence
was amplified from genomic DNA from L. monocytogenes EGD-e with proof reading polymerase Pfu and
primer pair ActA-2 and ActA-3(SacINotI). After digestion of this actA promoter containing fragment with SacI
and of the polT7-containing fragment with PstI, fragments were ligated in one step with PstI/SacI linearised
plasmid pUC18. All PCR products were sequenced after subcloning using the “CEQ TM 2000 Dye Terminator
Cycle Sequencing with Quick Start” kit (Beckman Coulter Inc., Fullerton, USA) in a CEQ TM 2000XL capillary
sequencer (Beckman Coulter Inc.). The resulting 2.9 kb PactA-polT7 fragment was excised by SacI and PstI and
ligated into the shuttle vector pSP0 (Pilgrim et al., 2003), giving rise to plasmid pCSA0. Alternatively, this
fragment was cloned accordingly into plasmid pSP118 (Pilgrim et al., 2003) containing the lysis gene from
phage A118 placed under the control of P actA, resulting in plasmid pCSA1. Introduction of plasmid pCSA0 into
L. monocytogenes strain WL-140 (Pilgrim et al., 2003) resulted in strain S6, introduction of plasmid pCSA1 into
L. monocytogenes strains WL-140 and WL-142 in strains S12 and S65, respectively. Electroporation of plasmid
pFLO1 (Dietrich et al., 1998) into S12 resulted in strain S13. To generate a polT7 encoding plasmid without a
listerial promoter sequence upstream of the polT7 coding sequence, a fragment containing the polT7 gene was
isolated from plasmid pPOLT7 using the primer pair PolT7-1(NotISacI) and PolT7-3(NotIPstI) as described
above. The fragment was inserted into pUC18 linearised with PstI and SacI. The construct was sequenced and
finally inserted by ligation into plasmid pSP118, giving rise to plasmid pCSA2. Electroporation of plasmid
pCSA2 lead to strain S29. For the generation of a plasmid for the transcription of an EGFP-mRNA directly by
the listerial RNA polymerase, an actA promoter containing fragment was amplified using primer pair ActA1(XmaIHindIII) and ActA-2 and subcloned into plasmid pCSB2 (see below) cut with SmaI. After sequencing,
the recombinant fragment containing PactA-IRESEMCV-egfp was excised and ligated into plasmid pSP118
linearised with SacI and PstI giving rise to plasmid pCSA3. Plasmid pCSA3 was electroporated into L.
monocytogenes strain WL140 resulting in strain S57. To generate a plasmid for bacterial GFP-expression, a 737
bp fragment containing the entire gfpmut 2 coding sequence was amplified via PCR with proof reading
polymerase Pfu using plasmid pKEN as template and the primer pair gfpmut2(-)(PstI) and gfpmut2(+). After
digestion with PstI and 5’ phosphorylation, the resulting fragment was subcloned into pUC18 together with a
SacI digested 250 bp actA promoter fragment obtained with primer pair ActA-2 and ActA-3(SacINotI) as
described above. After sequence verification, the recombinant fragment P actA-gfp was ligated via SacI/PstI into
plasmid pSP118 giving rise to plasmid pCSA4 which was finally introduced into strains WL-140 and WL-142,
resulting in strains S51 and S54, respectively.
Supplementary material Schoen et al.
2
Derivatives of pFLO1. Oligonucleotide pairs T7-EPK anti-s 2/T7-EPK s-1 and T7-EPK s-2/T7EPK
anti-s 1, respectively, were annealed and the resulting double stranded fragments were used as templates in a
recombinant PCR with primers T7-EPK s and T7-EPK anti-s for the amplification of a 224 bp T7 expression
cassette containing a mutated variant of the bacteriophage T7 promotor 10 (PT7) followed by a multiple cloning
site and a transcriptional terminator (T T7). After subcloning via PstI and SacI into plasmid pUC18 generating
pUC18-PT7-TT7 and sequencing, the PT7-TT7 fragment was cloned into shuttle vector pFLO1 to give plasmid
pCSB0. Finally, a 1.3 kb fragment from plasmid pIRES2-EGFP (Clontech) containing the egfp coding sequence
downstream of an EMCV IRES element was inserted between the XmaI/NotI sites of plasmid pCSB0 resulting in
plasmid pCSB1. Electroporation of pCSB1 into strain S6 yielded strain S19, electroporation of pCSB1 into
strains S12 and S65 yielded strains S15 and S68, respectively. Introduction of plasmid pCSB1 into strain S21
resulted in strain S22. Electroporation of plasmid pCSB1 into strain S29 gave strain S31. For the generation of
an IRES-egfp containing plasmid without a T7 promoter/terminator, plasmid pIRES2-EGFP was digested with
DraI and PstI and the IRES-egfp containing fragment was placed into pFLO1 linearised with SmaI and PstI,
resulting in plasmid pCSB2. Electroporation of strain S12 with pCSB2 gave strain S23. To generate a plasmid
encoding egfp together with the T7 promoter/terminator but without an IRES element, the egfp gene containing
NotI fragment from plasmid pSP118-EGFP was cloned into pCSB0 and the resulting plasmid was named
pCSB3. This plasmid was introduced into strain S12 giving rise to strain S25. For the construction of Listeria
strains expressing GFP via POLT7 mediated transcription, a fragment containing the gfpmut 2 gene together
with the Shine-Dalgarno sequence (SD) was excised with PstI and XmaI from plasmid pKEN (Cormack et al.,
1996) and ligated into plasmid pUC18-PT7-TT7 cut with NsiI and XmaI. The resulting plasmid was named
pUC18-PT7-SD-gfp-TT7 and digested with enzymes PstI and SacI. Ligation of the PT7-SD-gfp-TT7 containing
fragment into plasmid pFLO1 cut with the same enzymes lead to plasmid pCSB4. Introduction of plasmid
pCSB4 into strains S12 and S65 resulted in strains S17 and S67, respectively. To test the influence of a 3’ poly
A-tail on the translation of the EGFP-mRNA transcribed from plasmid pCSB1 by T7 RNA polymerase inside
the bacterial carrier, the 5’ phosphorylated oligonucleotides PolyA and PolyT were annealed and ligated into
plasmid pCSB1 via NotI downstream of the egfp coding sequence, resulting in plasmid pCSB5 which was finally
introduced into strain WL-140 giving rise to strain S63. To create a DNA-delivery strain harbouring the phage
lysin gene ply118 on plasmid pSP118 and the eucaryotic expression cassette separately on a second plasmid,
plasmid pIRES2-EGFP was digested with DraI and NsiI and the resulting 3,3 kb fragment containing P CMVIRESEMCV-egfp was ligated into plasmid pFLO1 linearised with PstI and SmaI. The resulting plasmid pCSB6
was introduced into strain S21 giving rise to strain S37. To construct a plasmid for the PolT7 directed expression
of a non-secreted variant of chicken ovalbumine, plasmid pSP118-OVACyt (D. Löffler) was digested with NcoI
and NotI and a 786bp fragment containing the coding sequence for OVACyt was isolated. In parallel, a 596 bp
fragment containing the EMCV IRES element was cut out from plasmid pIRES2-EGFP using enzymes NcoI and
XmaI. Both fragments were ligated in one step into plasmid pCSB0 which has been linearised before with XmaI
and NotI. The resulting plasmid pCSB7 was introduced vie electroporation into strain S12 resulted in strain
S62N.
Supplementary material Schoen et al.
3
Legend to supplementary figure:
Figure S1: EGFP expression in Caco-2 cells 4 h after infection with the DNA delivery strain S1, the RNA
delivery strain S15 and strain S22 used as negative control, respectively, at two different MOIs.
Supplementary material Schoen et al.
4
Table S1. Oligonucleotide primers used for the construction of plasmid vectors.
designation
sequence (5’  3’)
ActA-1(XmaIHindIII)
AAAACCCGGGTGAAGCTTGGGAAGCAGTTGGGGTTAACTG
ActA-2
TTATACTCCCTCCTCGTGATACGC
ActA-3(SacINotI)
AAAAGAGCTCGCGGCCGCTGAAGCTTGGGAAGCAGTTGGGGTTAACTG
gfpmut2(-)(PstI)
ATGCCTGCAGGTCTGGACATTTATTTG
gfpmut2(+)
ATGAGTAAAGGAGAAGAACTTTTCACTGG
POLT7-1
ATGAACACGATTAACATCGC
PolT7-1(NotISacI)
AAAAGAGCTCGCGGCCGCATGAACACGATTAACATCGC
POLT7-3(NotIPstI)
AAAACTGCAGGCGGCCGCTTACGCGAACGCGAAGTCCG
PolyA
GGCCGC(A)98C
PolyT
GGCCG(T)98GC
T7-EPK anti-s
TTTTGAGCTCCGTAATACGACTCACTATAGG
T7EPK anti-s 1
TTTTGAGCTCCGTAATACGACTCACTATAGGGCGAATTGCCCGGGCACCGCGGTGGCGGCCGCA
T7-EPK anti-s 2
AAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGT
T7-EPK s
ATCGCTGCAGCGATCCGGATATAGTTCC
T7-EPK s-1
ATCGCTGCAGCGATCCGGATATAGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACCCGTTTAGA
T7-EPK s-2
GGCAGCAGCCAACTCAGCTTCCTTTCGGGCTTTGTTAGCAGCCGGATCCACTAGTATGCATGCGGCCGCCACCGCGGTGCC
Supplementary material Schoen et al.
References
Conrad, B., Savchenko, R.S., Breves, R. and Hofemeister, J. (1996) A T7 promoter-specific, inducible protein
expression system for Bacillus subtilis. Mol Gen Genet. 250: 230-236.
Cormack, B.P., Valdivia, R.H. and Falkow, S. (1996) FACS-optimized mutants of the green fluorescent protein
(GFP). Gene. 173: 33-38.
Dietrich, G., Bubert, A., Gentschev, I., Sokolovic, Z., Simm, A., Catic, A., et al (1998) Delivery of antigenencoding plasmid DNA into the cytosol of macrophages by attenuated suicide Listeria monocytogenes.
Nat Biotechnol. 16: 181-185.
Pilgrim, S., Stritzker, J., Schoen, C., Kolb-Maurer, A., Geginat, G., Loessner, M.J., et al (2003) Bactofection of
mammalian cells by Listeria monocytogenes: improvement and mechanism of DNA delivery. Gene
Ther. 10: 2036-2045.
Sambrook, J. and Russell, D. (2000) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press.
5