Supplementary materials
Routine molecular manipulations. These were done as described in Wexler et al. (2001).
Strains and plasmids used in this study are shown in Supplementary Table 1.
Construction and use of transcriptional lac fusion plasmids.
The reporter plasmid pBIO1878 was made by cloning a 2 kb BamHI SpcR cassette fragment from
plasmid pHP45 (Prentki and Krisch, 1984) into the BglII site of pMP220, which is a wide hostrange promoter-probe plasmid with a lacZ gene lacking its native promoter (Spaink et al., 1987).
The region of the R. pomeroyi genome (Moran et al., 2004; see http://cmr.jcvi.org/cgibin/CMR/GenomePage.cgi?org=gsi) that spanned the promoter regions of both dddW and the
divergently transcribed regulatory gene SPO0454 was amplified from genomic DNA using primers
shown in Supplementary Table 2 and cloned into pBIO1878 to form fusion plasmids pBIO1945
(dddW-lacZ) and pBIO1947 (SPO0454-lacZ). These plasmids were transferred in separate triparental conjugational matings with E. coli containing the mobilising plasmid pRK2013 as the helper
strain (Figurski & Helinski, 1979) and R. leguminosarum 3841 (Young et al., 2006) or J470 (R.
pomeroyi rifampicin-resistant mutant) as the recipients, selecting transconjugants on media with
streptomycin (400 g ml-1) or rifampicin (20 g ml-1) plus spectinomycin (200 g ml-1).
Transconjugants were grown overnight in marine basal medium (MBM) with succinate (10 mM) as
carbon source (González et al., 1997) or Y minimal (Beringer, 1974) liquid media for Ruegeria
pomeroyi and Rhizobium leguminosarum respectively. These media either contained or lacked 5
mM DMSP. The cells were assayed for -galactosidase activity essentially as described by Rossen et
al. (1985).
The effects of the putative regulatory gene SPO0454 on the expression of the dddW-lacZ and the
SPO0454-lacZ fusions in Rhizobium were determined by first amplifying SPO0454, plus its native
promoter from genomic DNA using primers shown in Supplementary Table 2 and cloning the
resultant fragment into the wide host-range plasmid vector pOT2 (Allaway et al., 2001) to form
pBIO1946. This plasmid was mobilized in tri-parental matings into R. leguminosarum strains that
contained the dddW-lacZ fusion or SPO0454-lacZ plasmids, selecting gentamicin-resistant (20 g ml-
1
1)
transconjugants, prior to assaying -galactosidase activity after growth in the presence or
absence of 5 mM DMSP.
Assaying function of DddW DMSP lyase in E. coli
The dddW gene was amplified from R. pomeroyi genomic DNA using the primers shown in
Supplementary Table 2 and the PCR product was cloned into the expression vector pET21a
(Novagen), forming plasmid pBIO1948 , which was transformed into E. coli BL21. The resulting strain
was assayed for DMSP-dependent DMS production as in Todd et al. (2011) and the ability of cellfree extracts to convert [1-14C]DMSP into labeled acrylate was determined as in Todd et al. (2010;
2011).
Mutating dddW of Ruegeria pomeroyi
An insertional mutation into dddW of R. pomeroyi strain J470 was made in a similar way to that
described for other mutations in other genes (eg. dddQ) in this strain (Todd et al., 2011). A fragment
internal to dddW was amplified from genomic DNA using primers shown in Supplementary Table 2
and this was cloned into the insertional “suicide” plasmid pBIO1879, a derivative of the pKT19mob
(Schäfer et al., 1994) into which a spectinomycin resistance cassette had been cloned. The resultant
plasmid, pBIO1949, was mobilized into J470, selecting spectinomycin and kanamycin-resistant transconjugants. The insertional mutation into dddW was ratified by Southern blotting of genomic
DNA from this mutant strain.
References
Allaway D, Schofield NA, Leonard ME, Gilardoni L, Finan TM, et al. (2001) Use of differential
fluorescence induction and optical trapping to isolate environmentally induced genes. Env
Microbiol 3: 397–406.
Beringer JE (1974) R factor transfer in Rhizobium leguminosarum. J Gen Microbiol 84: 188-198.
Figurski DH, Helinski DR (1979) Replication of an origin-containing derivative of plasmid RK2
dependant on a plasmid function provided in trans. Proc Nat’l Acad Sci USA 76: 1648-1652.
González, JM, Mayer F, Moran MA, Hodson, RE, Whitman WB (1997). Sagittula stellata gen. nov.,
sp. nov., a lignin-transforming bacterium from a coastal environment. Int. J. Syst. Bacteriol.
47:773–780.
Moran MA, Buchan A, González JM, Heidelberg JF, Whitman WB, Kiene RP, et al (2004) Genome
sequence of Silicibacter pomeroyi reveals adaptations to the marine environment. Nature 432:
910-913.
Prentki P, Krisch H (1984) In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:
303-313.
2
Rossen L, Shearman CA, Johnston AWB, Downie JA. (1985) The nodD gene of Rhizobium
leguminosarum is autoregulatory and in the presence of plant exudate induces the nodA,B,C
genes. EMBO J. 16:3369-3373.
Schäfer A, Tauch A, Jager W, Kalinowski J, Thierbach G, et al. (1994) Small mobilizable multi-purpose
cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined
deletions in the chromosome of Corynebacterium glutamicum. Gene 145: 69–73.
Spaink HP, Okker RJH, Wijffelman CA, Pees E, Lugtenberg BJJ (1987) Promoters in the nodulation
region of the Rhizobium leguminosarum Sym plasmid pRL1JI. Plant Mol Biol 9: 27-39.
Studier FW, Moffat BA (1986) Use of bacteriophage T7 RNA polymerase to direct selective highlevel expression of cloned genes. J Mol Biol 189: 113-130.
Vieira J, Messing J (1982) The pUC plasmids, and M143mp7-derived system for insertion
mutagenesis and sequencing with synthetic universal primers. Gene 19: 259–268.
Wexler M, Yeoman KH, Stevens JB, de Luca NG, Sawers G, Johnston AWB (2001) The Rhizobium
leguminosarum tonB gene is required for the uptake of siderophore and haem as sources of
iron. Mol Microbiol 41: 801-816.
Wood WB (1966) Host specificity of DNA produced by Escherichia coli: bacterial mutations affecting
the restriction and modification of DNA. J Mol Biol 16: 118-133.
3
Supplementary Table 1
Strain / Plasmid
Description/use
Escherichia coli BL21
E. coli 803
E. coli JM101
Rhizobium leguminosarum 3841
Ruegeria pomeroyi DSS3 J470
Ruegeria pomeroyi DSS3 J497
pET21a
pHP45
pMP220
Used as host for expression from pET21a
Routine host for recombinant plasmids
Used when cloning into pBIO1879
Wild type strain (StrR)
Wild type strain (RifR)
R. pomeroyi J470 with insertion in dddW
Plasmid expression vector
Plasmid with SpcR
Studier and Moffat (1986)
Wood (1966)
Vieira and Messing (1982)
Young et al. (2006)
Todd et al., (2011)
This study
Novagen
Prentki and Krisch (1984)
Wide host range lacZ reporter plasmid
(TetR)
Wide host range plasmid (GentR)
Used as helper in conjugation (KanR)
SpcR derivative of pMP220
Suicide vector used for insertional
mutagenesis (KanR SpcR)
SPO0453 (dddW) promoter cloned into
pBIO1878
SPO454 (lysR) and its promoter cloned
into pOT2
SPO0454 (lysR) promoter cloned into
pBIO1878
SPO0453 (dddW) cloned into pET21a
Internal fragment of SPO0453 (dddW)
cloned into pBIO1879
Spaink et al. (1987)
pOT2
pRK2013
pBIO1878
pBIO1879
pBIO1945
pBIO1946
pBIO1947
pBIO1948
pBIO1949
Reference
Allaway et al. (2001)
Figurski and Helinski (1979)
This study
Todd et al. (2011)
This study
This study
This study
This study
This study
4
Supplementary Table 2 –Primers used in this study
Primer
Sequence
Used to:
Wprom1
GCGAATTCCATCGTCAGCAGAGTC
Wprom2
GCCTGCAGCACCATGTCGCGCGGCG
454P1
ATCTGCAGCAAACCGCGCTATTTGTGACT
454P2
ATGTCGACAGATCGGTTGCGAAACTGTCG
454prom1
GGCCGAATTCGGCGATGCCCAG
454prom2
AACTGCAGGCGCACCAGCGCGCC
Wpet1
Wpet2
Wmut1
AACTGCAGCATATGACCGCCATGCTCGAC
AGTTTC
ATGGATCCTCAGGCGCTGGCGGTGAACCG
CGGGATCCAGCCCGGCAACCTGCCG
clone promoter of R. pomeroyi DSS-3 dddW into
pBIO1878
clone promoter of R. pomeroyi DSS-3 dddW into
pBIO1878
clone R. pomeroyi DSS-3 SPO0454 and its
promoter into pOT2
clone R. pomeroyi DSS-3 SPO0454 and its
promoter into pOT2
clone promoter of R. pomeroyi DSS-3 SPO0454
gene into pBIO1878
clone promoter of R. pomeroyi DSS-3 SPO0454
gene into pBIO1878
amplify dddW of R. pomeroyi DSS-3
Wmut2
CGGGATCCATAGGCAAAGCGCAGACC
amplify dddW of R. pomeroyi DSS-3
clone internal fragment in dddW of R. pomeroyi
DSS-3
clone internal fragment in dddW of R. pomeroyi
DSS-3
Sequences of the oligonucleotide primers are shown, the restriction sites that were used for cloning
being underlined.
5