Experiments Ethanol consumption (g/kg/day) during stabilization period with 10% ethanol in drinking water Total fluid consumed (g/kg/day) Number of mice Immunohistochemistry 9.42 ± 0.57 140.50 ± 13.62 Water n=6 Ethanol n=9 RT-qPCR 9.17 ± 0.62 140.00 ± 17.84 Water n=6 Ethanol n=9 Protein analysis (Western Blot/ELISA) 10.60 ± 0.53 135.30 ± 10.25 Water n=6 Ethanol n=9 ChIP 10.48 ± 0.45 146.30 ± 14.15 Water n=6 Ethanol n=9 Neurogenesis 2 weeks: 10.24 ± 0.99 4 weeks: 9.25 ± 0.33 149.50 ± 9.80 144.30 ± 8.79 Water 2 weeks n=6 Ethanol 2 weeks n=9 Water 4 weeks n=6 Ethanol 4 weeks n=9 ANA-12 Ethanol vehicle-treated: 9.54 ± 0.88 Ethanol ANA12-treated: 8.87 ± 0.77 139.50 ± 17.70 134.00 ± 13.53 Water vehicle-treated n=6 Ethanol vehicle-treated n=9 Water ANA12-treated n=6 Ethanol ANA12-treated n=9 Table S1: Ethanol intake and total fluid consumed in the different groups of mice with free access to 10% ethanol that had been included in the various experimental series. mRNA expression analysis Genes 5’ primer 3’ primer Gdnf TGGGTTTGGGCTATGAAACC AACATGCCTGGCCTACTTTG Fgf-1 GCGGTCCTCGGACTCACTA AGCCAATGGTCAAGGGAAC Fgf-2 TATGAAGGAAGATGGACGGC TCGTTTCAGTGCCACATACC Trkb TGGACCACGCCAACTGACATT GAATGTCTCGCCAACTTGAG Bcl-2 ATGACTGAGTACCTGAACCG ATGCTGGGGCCATATAGTTC Bdnf I GTGTGACCTGAGCAGTGGGCAAAGGA - Bdnf II GGAAGTGGAAGAAACCGTCTAGAGCA - Bdnf III GCTTTCTATCATCCCTCCCCGAGAGT - Bdnf IV CTCTGCCTAGATCAAATGGAGCTTC - Bdnf V CTCTGTGTAGTTTCATTGTGTGTTC - Bdnf VI GCTGGCTGTCGCACGGTTCCCATT - Bdnf VII CCTGAAAGGGTCTGCGGAACTCCA - Bdnf VIII GTGTGTGTCTCTGCGCCTCAGTGGA - Bdnf IX TGCAGGGGCATAGACAAAAG TGAATCGCCAGCCAATTCTC BDNF Rev - GAAGTGTACAAGTCCGCGTCCTTA Hprt GATGATGAACCAGGTTATGAC GTCCTTTTCACCAGCAAGCTTG β-actin CCACCATGTACCCAGGCATT CGGACTCATCGTACTCCTGC Table S2: Primer sequences used for quantitative real-time PCR analysis of mRNAs with Absolute SYBR Green technology. mRNA expression analysis Genes References Mecp2 Mm01193537_g1 Mbd1 Mm01262472_g1 Ncor Mm00448681_m1 Hdac1 Mm02745760_g1 Hdac2 Mm00515108_m1 Hdac3 Mm00515916_m1 Hdac4 Mm01299565_m1 Hdac5 Mm00515941_g1 Hdac9 Mm00458454_m1 Mash1 Mm03058063_m1 Neurod1 Mm01280117_m1 Neurog1 Mm00440466_s1 Neurog2 Mm00437603_g1 Id2 Mm01293217_g1 Id3 Mm00492575_m1 Gapdh Mm99999915_g1 Table S3: References of primers used for quantitative real-time PCR analysis of mRNAs with Taqman technology. ChIP analyses Gene promoters 5’ primer 3’ primer Bdnf PII GGGGTGGAGAGGGTAAGAGT GTTTTGTCACGTGTGGATGG Bdnf PIII TATCCCTGCCTCCCTCTCTT CGGGGAGGGATGATAGAAAG Bdnf PVI AAATGGAGAGAAGCCAGTGC TCTTCGGTTGAGCTTCGATT Bdnf PVIII TGACCCACATGGATTGTGAC TGGAGAAAACTGGTGGTTCC Gapdh CTCCCAGGAAGACCCTGCTT GGAACAGGGAGGAGCAGAGA Table S4: Primer sequences used for ChIP analyses. Gene Mecp2 Water 1.005 ± 0.040 (6) Ethanol 1.278 ± 0.051 (8) Percent over Water +27.16 Mbd1 1.005 ± 0.038 (6) 1.076 ± 0.055 (8) +7.06 ns Ncor 1.005 ± 0.049 (6) 0.788 ± 0.050 (8) -21.59 ** Hdac1 1.003 ± 0.027 (6) 0.798 ± 0.059 (9) -20.44 ** Hdac2 1.000 ± 0.026 (6) 0.822 ± 0.029 (9) -17.80 * Hdac3 1.005 ± 0.048 (6) 0.954 ± 0.042 (9) -5.07 ns Hdac4 1.003 ± 0.040 (6) 1.169 ± 0.027 (8) +16.55 ns Hdac5 1.008 ± 0.029 (6) 0.715 ± 0.030 (8) -29.07 **** Hdac9 1.000 ± 0.024 (6) 1.025 ± 0.041 (8) +2.50 ns P value *** Table S5: Effects of chronic ethanol intake on hippocampal levels of mRNAs encoding transcriptional repressors. mRNA levels were measured by real-time RT-qPCR in the hippocampus of “water” and “ethanol” mice. Results [mean ± S.E.M. of (n) mice] are expressed as arbitrary units after normalization to the endogenous reference genes encoding Gapdh or Hprt and β-actin. * p <0.05, ** p <0.01, *** p <0.001, **** p <0.0001, significantly different in “ethanol” versus “water” mice, ns: not significant, one way ANOVA followed by Bonferroni’s multiple comparison test. Gene Water Ethanol Percent over Water Mash1 0.941 ± 0.069 (6) 0.750 ± 0.041 (7) -20.30 ns Neurod1 1.003 ± 0.034 (6) 1.151 ± 0.045 (8) +14.76 ns Neurog1 1.012 ± 0.075 (6) 1.238 ± 0.062 (8) +22.33 ns Neurog2 1.020 ± 0.088 (6) 1.340 ± 0.094 (8) +31.37 ** Id2 1.017 ± 0.083 (6) 1.171 ± 0.034 (7) +15.14 ns Id3 1.054 ± 0.102 (6) 0.771 ± 0.064 (7) -26.85 * P value Table S6: Effects of chronic ethanol intake on hippocampal levels of mRNAs encoding transcription factors of the bHLH family. mRNA levels were measured by real-time RT-qPCR in the hippocampus of “water” and “ethanol” mice. Results [mean ± S.E.M. of (n) mice] are expressed as arbitrary units after normalization to the endogenous reference genes encoding Gapdh or Hprt and β-actin. * p <0.05, ** p <0.01 significantly different in “ethanol” versus “water” mice, ns: not significant, one way ANOVA followed by Bonferroni’s multiple comparison test.