The origin and evolution of a new chimeric gene in Drosophila melanogaster
Ren Juan, Biological Science, Grade 2003
Directed by
Zhang Huaiyu (Professor, Sichuan Agricultural University)
Wang Wen (Professor, Kunming Institute of Zoology the Chinese Academy of Science)
Abstract: A new chimeric gene GENE18 in Drosophila melanogaster originated about 2.5 mya
ago after the divergence of the D.melanogaster species. P-element transposition which induced
gene disruption was used here to create loss function lines. Through crossing with different fruit
fly lines for five generations, the disrupted lines with the genotype ‘yw/Y; +/+; P[gene-]/
P[gene-]’ and ‘yw/yw; +/+; P[gene-]/P[gene-]’were selected by the phenotype with white eyes,
slender body, long bristles and straight wings. And further more, the DNA amplification products
showed that the disrupted lines had lost fragments longer than 2kb in the 5’region of this new
gene. Some observation indicated that the individual fitness in the homologous disrupted lines
was poorer than one in the heterozygous lines and the non-disrupted lines.
Key words: chimeric gene, gene duplication, exon shuffling, homologous line, EP
1 Introduction
Evolution is an old topic since Darwin’s “the origin of species” and evolutionists used variant
tools to verify their hypotheses about evolution. As the whole genomes of various organisms are
sequenced scientist is gradually focusing on the evolutionary history of new genes in genomes
using molecular evolution tools [1] ~ [2]. Modular organisms are the pioneers which are put into the
river of evolution, such as yeast, worm and fruit fly, etc. With the clear genetic background and
the convenient cultivation fruit fly becomes the best modular organism to investigate the origin
of new genes. The study of ancient genes highlights the antiquity and general importance of
some mechanisms of gene origination, and recent observations on young genes at early stages
have unveiled unexpected molecular and evolutionary processes [3].
Having avoided the missing data newly evolved genes are the keys to unlock the
1
evolutionary mystery. Evolutionists expect to explore laws of evolution with molecular evolution
tools. New genes contribute a lot to the high diversity of species. It is fantastic to study the origin
of new genes that originated recently as well as to disclose the mystery of their evolutionary
processes. New genes provide more information than old ones which lost most of the data during
long-term evolution.
Recently, a new chimeric gene GENE18 was screened in the genome of D.melanogaster
using cDNA alignments. It is a non-coding gene in the third chromosome of D.melanogaster
created by partial duplication and exon shuffling [4]. The evolutionary process has been clarified
using evolution computation method (Zhan Zubing, etc. not published ). However, as it is
referred above, it is not sufficient for understanding the process during evolution. And it was
argued that partial duplication in conjunction with gene fusion and shuffling events can lead to
an immediate acquisition of a novel function conferring a great selective advantage [5].
The aim
of this investigation was to explore some novel function of this non-coding gene GENE18 which
might enrich the understanding of the evolutionary process of this novel gene.
The origin and evolution of GENE18
As it was mentioned, there were several mechanisms to create new genes, especially gene
duplication and exon shuffling
[6]
. Using cDNA of D.melanogaster to align with the whole
genomes of D.melanogaster, D.simulans, D.sechellia, D.yakuba and D.erecta, GENE18 was
found only in D.melanogatster [7]. And the structure of this gene was clarified using BLAST and
DNA sequencing. It was created by exon shuffling of the two partial duplications of GENE17
and GENE40 respectively which were in chromosome III as well as this new gene after the
divergence of D.melanogaster 2.5 mya ago（Figure1the evolution tree of D.melanogaster
species）. There are two adjacent genes to this chimeric gene. There was one deletion in the first
exon and thirty-one deletions in the third exon which came from GENE17. And also there were
four deletions in the third exon that came from GENE40. Figure 2 was the formation and
structure of GENE18. For the reason that there were several pre-terminated stop codons and
frame shift mutation in the ORF contrasted to original two duplication fragments of the parental
genes, we presumed that it was a non-coding gene which was not the same as it was annotated in
the Database of NCBI and Flybase. It might be an RNA gene or a pseudo gene. But it was
2
presumed it to be an RNA gene with novel functions for three reasons. First it expressed in
embryo. Second there are two isforms in male D.melanogaster while only one in female. Third it
is relatively conserved to its parental genes
[8]
and there are only several changes in the
nucleotides and deletions in sequences.
Figure 1 GENE18 evolution tree
Figure 2 The origin and structure of GENE18
3
Function research
Recently it has been observed that RNA genes play an important role in the history of
evolution [9] ~ [10]. And it is crucial to study the evolution of RNA genes in order to understand the
divergence of biological diversity. For instance, an RNA gene sphinx had been detected to have
something to do with the courtship of the male fruit fly
[10]
.Once it was knocked out the male
would propose male instead of female like a gay. The new gene GENE18 has two splicing
isforms in male fly but only one in female. So why did it evolve another isform? Did it have
another function in males? If so, what’s the new function? What’s more, did it have some relation
with its evolution process? So it needed to do the job of excision of this new gene and tried to
observe the novel function to validate the guesses.
Generally, gene knock-out, gene knock-down and over-expression are classic strategies to
study the function of target gene. And gene knock-out and knock-down are the direct way to
finish this job [9]. There are several ways to achieve gene knock-out, such as transposon-induced
deficiencies and homologous recombination [11], etc; examples are P-element excision and gene
targeting. For P-element excision, it is based on the fact that in most cases P-elements excise
imprecisely when transposing via the P transposase [12]. Most of these imprecise excision events
delete sequences from the P elements behind. However, in a reasonable proportion of excisions
(~10%) flanking genomic DNA is removed by the P elements, and produces small deletions
around the original P element insertion point [13] ~ [14]. The use of this approach allows to create
local mutations in genes neighboring the original P insertion, e.g. in lines of the P[gene]
insertions that do not have a phenotype by itself. While for targeting like ends-out and ends-in, it
is complex and low efficiency to create destructed genes.
For the help of Berkeley Drosophila Genome Project, there are numerous P-elements
insertion lines in stock centers . We had got the insertion line EP3 of this new gene in Szeged
Drosophila Stock Centre in Hungary, so it was convenient to excision the target new gene
GENE18 in Chromosome 3 just using classic genetics method. Before the gene was excised what
it needed to balance the three chromosomes(1,2,3) to preclude the recombination of each
chromosome in case that exchange of chromosomes may affect the phenotype of the knock-out
line. The balance line “yw/yw; sp/cyO; MKRS/TM6B” was usually used during gene deletion.
Then “yw/yw; sp/cyO; △2-3, Sb /TM6B” line was used for the transposition of EP. Once it had
4
got the excision of GENE18 we must change the chromosome back to wild type. So the
phenotype of gene excision line wouldn't be affected by the balancer.
Using classic genetics and modern molecular tool we designed a scheme to gain a
homologous line with disrupted gene to clarify the novel function of GENE18. We tried to find
out whether it was an RNA gene with special function such as sphinx. So we used P-element
excision to knock out this new gene to find out the truth.
2 Materials and methods
2.1 Disruption of gene
2.1.1 Materials
Three lines of D.melanigaster: EP3 (yw/yw; +/+; P[gene]/P[gene]), yw/Y; sp/cyO;
MKRS/TM6B, yw/yw; sp/cyO; △2-3, Sb/TM6B.
2.1.2 Methods
1st generation (balance)
MM (many males) and mm (many females)
yw/Y; +/+; P[gene]/P[gene] × yw/yw; sp/cyO; MKRS/TM6B
↓
yw/yw; +/cyO; P[gene]/TM6B
yw/Y ; +/cyO; P[gene]/TM6B
yw/yw; +/cyO;p[gene]/MKRS
yw/Y ; +/cyO; p[gene]/MKRS
yw/yw; +/sp; p[gene]/TM6B
yw/Y ; +/sp; p[gene]/TM6B
yw/yw; +/sp; p[gene]/MKRS
yw/Y ; +/sp; p[gene]/MKRS
‘yw/Y; +/cyO; P[gene]/TM6B’ lines were chosen for the next generation.
2nd generation balancing (here occurs the excision)
MM and mm
yw/Y; +/cyO; P[gene]/TM6B × yw/yw; sp/cyO; △2-3,Sb/TM6B
↓
yw/Y; +/sp; P[gene-]/△2-3,Sb
yw/yw; +/sp; P[gene-]/△2-3,Sb
yw/Y; +/sp; P[gene-]/TM6B
yw/yw; +/sp; P[gene-]/TM6B
yw/Y; +/cyO; P[gene-]/△2-3,Sb
yw/yw; +/cyO; P[gene-]/△2-3,Sb
5
yw/Y; +/cyO; P[gene-]/TM6B
yw/yw; +/cyO; P[gene-]/TM6B
yw/Y; sp/cyO; P[gene-]/△2-3,Sb
yw/yw; sp/cyO; P[gene-]/△2-3,Sb
yw/Y; sp/cyO; P[gene-]/TM6B
yw/yw; sp/cyO; P[gene-]/TM6B
‘yw/Y; +/cyO; P[gene-]/△2-3, Sb and yw/yw; +/cyO; P[gene-]/△2-3,Sb’ lines were chosen for
the next generation.
3rd generation
M (single males, mosaic eye color) and mm (TM6B virgin female)
yw/Y; +/cyO; P[gene-]/△2-3,Sb × yw/yw; sp/cyO; MKRS/TM6B
↓
yw/Y; +/cyO; P[gene-]/TM6B
yw/yw; +/cyO; P[gene-]/TM6B
yw/Y; +/sp; P[gene-]/TM6B
yw/yw; +/sp; P[gene-]/TM6B
yw/Y; +/cyO; P[gene-]/MKRS
yw/yw; +/cyO; P[gene-]/MKRS
yw/Y; +/sp; P[gene-]/MKRS
yw/yw; +/sp; P[gene-]/MKRS
yw/Y; +/cyO; △2-3,Sb /MKRS
yw/yw; +/cyO; △2-3,Sb /MKRS
yw/Y; +/sp; △2-3,Sb /MKRS
yw/yw; +/sp; △2-3,Sb /MKRS
yw/yw; +/cyO; P[gene-]/△2-3,Sb × yw/Y; sp/cyO; MKRS/TM6B
↓
yw/Y; +/cyO; P[gene-]/TM6B
yw/yw; +/cyO; P[gene-]/TM6B
yw/Y; +/sp; P[gene-]/TM6B
yw/yw; +/sp; P[gene-]/TM6B
yw/Y; +/cyO; P[gene-]/△2-3,Sb
yw/yw; +/cyO; P[gene-]/△2-3,Sb
yw/Y; +/sp; P[gene-]/△2-3,Sb
yw/yw; +/sp; P[gene-]/△2-3,Sb
yw/Y; +/cyO; P[gene-]/MKRS
yw/yw; +/cyO; P[gene-]/MKRS
yw/Y; +/sp; P[gene-]/MKRS
yw/yw; +/sp; P[gene-]/MKRS
yw/Y; +/cyO; P[gene-]/MKRS
yw/yw; +/cyO; P[gene-]/MKRS
yw/Y; +/sp; P[gene-]/MKRS
yw/yw; +/sp; P[gene-]/MKRS
‘yw/Y; +/cyO; P[gene-]/TM6B, yw/Y; +/sp; P[gene-]/TM6B ’ lines were chosen for the next
generation.
6
4th generation (backcross with TM6B)
M(single male) and mm(several virgin female of TM6B)
yw/Y; +/cyO; P[gene-]/TM6B × yw/yw; sp/cyO; MKRS/TM6B
↓
yw/Y; +/sp; P[gene-]/TM6B
yw/yw; +/sp; P[gene-]/TM6B
yw/Y; +/sp; P[gene-]/ MKRS
yw/yw; +/sp; P[gene-]/ MKRS
yw/Y; +/sp; TM6B / MKRS
yw/yw; +/sp; TM6B / MKRS
yw/Y; +/cyO; P[gene-]/TM6B
yw/yw; +/cyO; P[gene-]/TM6B
yw/Y; +/cyO; P[gene-]/ MKRS
yw/yw; +/cyO; P[gene-]/ MKRS
yw/Y; +/cyO; TM6B / MKRS
yw/yw; +/cyO; TM6B / MKRS
yw/Y; sp/cyO; P[gene-]/TM6B
yw/yw; sp/cyO; P[gene-]/TM6B
yw/Y; sp/cyO; P[gene-]/ MKRS
yw/yw; sp/cyO; P[gene-]/MKRS
yw/Y; sp/cyO; TM6B / MKRS
yw/yw; sp/cyO; TM6B / MKRS
yw/Y; +/sp; P[gene-]/TM6B
×
yw/yw; sp/cyO; MKRS/TM6B
↓
yw/Y; +/sp; P[gene-]/TM6B
yw/yw; +/sp; P[gene-]/TM6B
yw/Y; +/sp; P[gene-]/ MKRS
yw/yw; +/sp; P[gene-]/ MKRS
yw/Y; +/sp; TM6B / MKRS
yw/yw; +/sp; TM6B / MKRS
yw/Y; +/cyO; P[gene-]/TM6B
yw/yw; +/cyO; P[gene-]/TM6B
yw/Y; +/cyO; P[gene-]/ MKRS
yw/yw; +/cyO; P[gene-]/ MKRS
yw/Y; +/cyO; TM6B / MKRS
yw/yw; +/cyO; TM6B / MKRS
yw/Y; sp/cyO; P[gene-]/TM6B
yw/yw; sp/cyO; P[gene-]/TM6B
yw/Y; sp/cyO; P[gene-]/ MKRS
yw/yw; sp/cyO; P[gene-]/MKRS
yw/Y; sp/cyO; TM6B / MKRS
yw/yw; sp/cyO; TM6B / MKRS
Then ‘yw/Y; +/cyO; P [gene-]/TM6B, yw/yw; +/cyO; P[gene-]/TM6B’ lines were chosen for the
next generation.
7
5th generation (brother-sister crossing)
M (sing male) and m (single female)
yw/Y; +/cyO; P[gene-]/TM6B
×
yw/yw; +/cyO; P [gene-]/TM6B
↓
yw/Y; +/+; P[gene-]/ P[gene-]
yw/yw; +/+; P[gene-]/P[gene-]
yw/Y; +/ cyO; P[gene-]/ P[gene-]
yw/yw; +/ cyO; P[gene-]/P[gene-]
yw/Y; +/+; P[gene-]/ TM6B
yw/yw; +/+; P[gene-]/ TM6B
yw/Y; +/ cyO; P[gene-]/ TM6B
yw/yw; +/ cyO; P[gene-]/ TM6B
‘yw/Y; +/+; P[gene-]/ P[gene-] and yw/yw; +/+; P[gene-]/P[gene-]’ were the disrupted lines
needed to be the next research.
2.2 Detection of the deletion lines by DNA amplification and sequencing
2.2.1 Design of primers
The targeted primers, two forward primers and reverse primers obtained by the primer
designer Oligo6.69. The followings were the primers we designed. And the positions of designed
primers and primers mel-R1, mel-R2 and seq2R used before (Zhan Zubing, not published yet)
were shown in figure3 as well as the positions of the two adjacent genes (gene1 and gene2) and
the regions AD1, AD2 among these three genes.
GENE18 F1
TAATTTAATGCAATCCGGTAC
GENE18 F2
ACATTTTACAGCCGACGTTAC
GENE18 R1
ATCACCATATTGGCGAGTTAC
GENE18 R2
TTGCAATTCCTTTCCGAAGCA
Figure 3
the relative positions
8
2.2.2 Detection of the excision lines
2.2.2.1 Extraction of the genome of W1118 wild type, ‘yw/Y; +/cyO; P[gene-]/TM6B’ and
‘yw/yw; +/cyO; P[gene-]/TM6B’ excision type fruit flies during the hybridization.
(1) Add cooled lysis Buffer B into sample flies (be sure to mix them together).
(2) Mill the flies in tubes, and then put them on ice.
(3) Put the samples in 65℃ for 40 minutes.
(4) Then cool the sample to room temperature, after that add RNase into them and digest at 37℃
for 40 minutes(be sure to mix them together).
(5) Cool the sample to room temperature, and then mix Prot.PPT into them for 6 minutes on ice.
(6) Centrifuge at 14000 rpm for 5 minutes.
(7) Take the limpid liquid into new tubes, and then Centrifuge at 14000 rpm for 5 minutes.
(8) Add Isopropanol into new tubes.
(9) Take the limpid liquid into Isopropanol on ice, and then vortex them tenderly.
(10) Centrifuge at 3000 rpm for 5 minutes.
(11) Discard the limpid liquid and add 700ul 70% ETOH to wash off the Isopropanol then
Centrifuge it at 3000 rpm for 3 minutes.
(12) Discard the limpid liquid and dry the DNA in air for 20 minutes.
(13) Add 30ul DNA Hydration Soln at room temperature for 1hr to dissolve DNA.
2.2.2.2 Perform PCR amplification to detect the deletion line with primer pairs including
GENE18 F2/GENE18 R2, GENE18 F2/melR1 and GENE18 F2/melR2 respectively in
W1118 and excision lines.
Preparation of the PCR mix
Forward primer
0.5ul
Reverse primer
0.5ul
dNTP
2ul
10×Buffer
2.5ul
Template DNA
2ul
rTaq
0.15ul
H2O
17.35ul
9
Thermal cycling
94℃
5minutes
94℃
30seconds
56℃
30seconds
72℃
2minutes
72℃
7minutes
10℃
forever
36cycles
2.2.2.3 Gel electrophoresis of the PCR products and Sequencing of the PCR products
3 Results and Discussion
3.1 Disruption of GENE18
1st generation
After the first generation the gene type ‘yw/Y; +/cyO; P[gene]/TM6B’ with red eye, curl wings
and long bristle markers was the right lines for the next generation. The male P-element insertion
line was used to cross with the balanced line. So there wouldn't be any recombination between
male and the balanced line. In this line every chromosome was balanced by balancers except the
X chromosome. But there was no exchange in the next generation, for the reason that there was
no recombination in male.
2nd generation
In the 2nd generation the flies with curls wings, mosaic eyes and short bristles were what we
needed (Figure 3 the mosaic eyes). “yw/yw; sp/cyO; △2-3, Sb/TM6B” line can provide
transposase, so during the embryo there will be P-element transposition. The somatic cells and
germ line cells might have excision in GENE18. For the reason that it couldn't be sure which
fruit fly had the excision so mosaic eye color fruit fly with gene marker cyO and sb had been
chosen to do the next generation crossing to obtain the excision lines.
10
Mosaic eyes
Figure 4
the mosaic eyes
3rd generation
The gene type ‘yw/Y; +/cyO; P [gene-]/ TM6B, yw/Y; +/sp; P [gene-]/TM6B’ was obtained for
the next generation. In this generation the markers MKRS (short bristle) and △2-3, Sb (short
bristle) were eliminated to avoid the mistakes of selection for the next generation.
4th generation
Both of the gene type ‘yw/Y; +/cyO; P [gene-]/TM6B, yw/yw; +/cyO; P [gene-]/TM6B’ were
right for the next generation. During this generation all the chromosomes came from flies with
one parental genotype to exclude the interference of the genetic background.
5th generation
Homologous gene types ‘yw/Y; +/+; P [gene-]/ P [gene-]’ and ‘yw/yw; +/+; P [gene-]/P [gene-]’
were the final target lines. These flies had long bristle, slender body and white eyes. In this
generation every chromosome was homologous. They would be kept for various experiments.
3.2 Detection of the disruption lines
Selection of the primers
There were different combinations of the forward and reverse primers. The primers designed
before (Zhan Zubing, not published yet) were also tested with the other four designed primers.
11
There were several types of matches. However, only GENE18 F2/melR2, GENE18F1/mel-R1,
GENE18/seq2R, F1/mel-R2 and GENE18 F2/melR2 worked in genome of W1118. So only these
five primer pairs could be used to detect excision lines.
Two pairs of primers up stream and down stream of GENE18 in two adjacent regions (AD1
and AD2) were designed respectively. In that case the P-element might excise the adjacent genes
(gene1 and gene2), it was necessary to exclude the additional excision of these two genes. The
two pairs of primers were about 500bp away from GENE18 in the two adjacent regions. Once it
could not be amplified in the fragment between these two 500bp adjacent base pairs it could be
speculated that the excision was too long to destroy the adjacent genes.
PCR amplification and gel electrophoresis
The tested five primer pairs were used to detect the excision lines during the 5th generation.
Here was part of the gel electrophoresis result of the PCR products in figure 5 with primer pairs
“F1/Seq2R” in the last four better candidates. Two strips were obtained. The longer strips were
the wild type gene and the shorter were the disruption gene. The contrast of the two strips
indicated that there were excisions more than 2kb in one of the homologous chromosomes. And
this excision didn’t contain the adjacent genes.
Figure 5 Amplification patterns obtained using primer pairs F1/Seq2R to identify disrupted lines
(arrowheads). Lane M, DL2000 marker; lane 1, W1118 wild type; lane 2 and 4, disrupted lines; lane 3,
non-disrupted line.
As it was known that the EP excised neighboring fragments imprecisely, if it excised too short
to destroy the new gene or so long to destroy the adjacent genes the excised lines would be
eliminated. Only the right excised lines would be kept to do the next generation cross. The
12
design of these primers was right to the need to avoid wrong selection of flies. And the capability
of being amplified with the primers in AD1 and in gene indicated that the adjacent gene 1 was
not destroyed. PCR products were sent to be sequenced.
4 Conclusions
Classic genetics tool was used to gain the gene disrupted line which would be the further
material to study the novel function of GENE18. Although sequencing is still in the progress, this
gene would not express with long fragments (about 2kb) loss in the 5’ region and it could be
presumed what would happen with the information Zhan provided
[15]
. According to his
observation of the EP3 line, the fitness of this line with homologous P-element insertion
chromosomes might be poorer than the heterozygous lines with only one P-element insertion
chromosome. And the new gene didn't express in the homologous insertion lines. This means
that the new gene was disrupted by the EP insertion. Maybe the new gene was just in the
pathway of some function mechanism [16]. However, it needs to do one more generation crossing
to verify whether the result answered for Mendel's law. And for the detailed function, it still
needed to be explored by further experiments like using gene chips to analyze the expression
spectrum.
During this experiment, the major problem was the selection of red-eye flies in the first
generation and mosaic-eye ones in the second generation. The red color was a little weak in the
crossed lines. So it needs more effort to differentiate the red eye and mosaic eye within white eye.
Nevertheless the plan was finished and the homologous disruption lines were gained. It paves the
way for the next step of analysis.
Acknowledgement
My thesis was finished in Key Laboratory of Cellular and Molecular Evolution of Kun Ming
Institute of Zoology The Chinese Academy of Science. Thanks to Mr. Wang who gave me the
guidance and opportunity. And thank very much to Zhan Zubing’s patient help. During this
period I learnt skills and knowledge about the investigation of molecular evolution. At the same
time, I want to own my thanks to Mrs. Yu in Yunnan University, Ding Yun, Zhao Ruoping,
13
Zhang Yue, Li Xin, Li Dan, Zhou Qi and Dong Yang of MP I. Thanks to their friendly help. At
last, thanks for guidance of Mrs. Zhang huaiyu and the help of Xu Guochao in Sichuan
Agricultural University.
References
[1]. Yu, H., Jiang et al. Origination and evolution of a human-specific transmembrane protein gene,
c1orf37-dup. Human Molecular Genetics. 2006
[2]. Long Manyuan et al. Natural selection and the origin of jingwei, a chimeric processed functional gene in
Drosophila. Science.1993
[3]. Long Manyuan et al. The origin of new genes: glimpses from the young and old. Nat Rev Genet. 2003
[4]. Wang, Wen et al. Duplication-degeneration as a mechanism of gene fission and the origin of new genes in
Drosophila species. Nature Genet. 2004
[5]. Patthy, L. Protein evolution. Blackwell Science Ltd., Oxford. 1999
[6]. Arguello, J.R et al. The Recent Origination of an X-linked Testes-specific Chimeric Gene by Illegitimate
Recombination in Drosophila.PLoS Genetics . 2006
[7]. Mark Stapleton et al. A Drosophila full-length cDNA resource. Genome Biology. 2002
[8]. Li W-H. Molecular Evolution. Sinaur Associates, Sunderland, Massachusetts, 1997.
[9]. Mia T. L et al. Novel genes derived from noncoding DNA in Drosophila melanogaster are frequently
X-linked and exhibit testis-biased expression. PNAS. 2006
[10]. Wen Wang et al. Origin of sphinx, a young chimeric RNA gene in Drosophila. PNAS.2002
[11]. Koen J.T et al. EMERGING TECHNOLOGIES FOR GENE MANIPULATION IN DROSOPHILA
MELANOGASTER. Nature genetics. 2005
[12]. Jolanta Szulc et al. A versatile tool for conditional gene expression and knockdow. Nature methods. 2006
[13]. Stephen, T. T et al. A complementary transposon tool kit for Drosophila melanogaster using P and
piggyBac. Nature genetics. 2004
[14]. Hugo J. Bellen et al. The BDGP Gene Disruption Project: Single Transposon Insertions Associated With
40% of Drosophila Genes. Genetics Society of America. 2004
[15]. Personal communication with Zhan.
[16]. Zhou, Qi et al. Comparative genomic analysis links karyotypic evolution with genomic evolution in the
Indian Muntjac. Chromosoma. 2006
14