Supplementary Methods
Extraction of GTs from Rose flowers
Flowers from rose (Rosa hybrida) cultivars of the Hybrid Tea group ‘Crimson Glory’, ‘Carl Red’,
‘Rote Rose’ and ‘Sterling Silver’, which bear cyanic flowers, were powdered in liquid nitrogen.
The powder was homogenized gently in 0.15M potassium phosphate buffer (pH 7.0) containing
14mM 2-mercaptoethanol (2-ME), 100mM NaCl, 5mM EDTA, 5mM ascorbate, 1%
polyvinylpyrrolidone K-30, 0.1% Triton X-100 and 10% glycerol. The homogenate was filtered
through four layers of gauze, and the filtrate was centrifuged. Solid (NH4)2SO4, was added to the
supernatant, bringing it to 10% saturation, stirred, and centrifuged. The supernatant fraction was
subsequently brought to 70% saturation of solid (NH4)2SO4 and re-centrifuged. The pellet was
dissolved in a minimum volume of Tris-HCl buffer (pH 8.0) containing 7mM 2-ME and desalted
through a Sephadex G-25 (Amersham Bioscience). To remove phenolic compounds, desalted
solutions were applied to a DEAE-cellulose (Whatman) column and eluted with DEAE elution
buffer (Tris-HCl buffer (pH 8.0) containing 7mM 2-ME and 0.5M NaCl). The eluant fraction
was desalted on a PD-10 column (Amersham Bioscience) and re-eluted with Tris-HCl buffer (pH
8.0) containing 7mM 2-ME.
Glucosyltransferase assay
To assay GT enzyme activity, 50μl reaction mixture consisted of 30μl crude enzyme
preparation (100-150μg protein in 50mM Tris-HCl buffer (pH 8.0) containing 7mM 2-ME) as
described above, 5nmol of the glucosyl acceptor (anthocyanidins or anthocyanins) and 10nmol
UDP-glucose. The mixture was incubated for 10 min at 30°C and stopped by the addition of
50 μl CH3Cl:CH3OH, 2:1(v/v; plus 10% HCOOH). Identification of reaction products was
carried out by HPLC analysis equipped with a reverse-phase column (Wakosil-II 5C18 AR,
Wako), was used a linear elution gradient (1ml/min) from 5 to 30% solvent B (0.5% TFA in
CH3CN) in solvent A (0.5% TFA, 5% CH3CN in H2O) over 20min with monitoring of
absorbance at 520nm as a standard method. Products were identified by co-chromatography with
authentic anthocyanins.
Isolation of RhGT and expression of recombinant protein in E. coli.
Total RNA was extracted from petals using a modified CTAB method1. cDNA was synthesized
with a First Strand cDNA Synthesis kit (Amersham). A degenerate primer, GTSPFd
(WCICAYTGYGGITGGAAYTC) was designed on the basis of the conserved PSPG-box. The
GT gene was amplified by PCR using the GTSPFd and NotI R1 primer
(AACTGGAAGAATTCGCGGC). A second PCR amplification was carried out using the
GTSPFd and NotI R2 primer (GAACGCGGCCGCAGGAAT). NotI R1 and R2 primer
sequences included in the NotId(T)18 primer (Amersham) were used for cDNA synthesis. PCR
were performed using the Expand High Fidelity PCR system (Boehringer Mannheim). Second
amplification PCR products were cloned in pGEM Easy T-vector (Promega) and sequenced, and
a GT-homologous clone was identified using BLAST X algorithm software. Full length cDNA
from petal mRNA was synthesized using a GeneRacer kit (Invitrogen) and the 5’ terminal region
of the GT-like gene was amplified using primer R1 (TTATGCGGGCCCAACATGCC) for a
first PCR amplification, primer R2 (CCACAGCTGAGCCAACTTGG) for a second
amplification. Amplified products were cloned in pGEM Easy T-vector (Promega) and
sequenced. The coding region of the GT-like gene was amplified by RT-PCR using GT-like
specific primers RhGTFd (GACGACGACAAGATGGGTGGTGATGCTATAGTTTG) and
RhGTRv (GAGGAGAGCCCGGTTCATTTTTGCTTCCACAGCTGAGCC), which contain
start and stop codons respectively, and a sequence for cloning in the pET vector (Novagen).
RT-PCR products were cloned in the pET vector (Promega) and sequenced. Recombinant
proteins were expressed in E. coli BL21(DE3)(Novagen). Transformed E. coli expressing the
recombinant GT protein was cultured overnight in 3ml of liquid 2YT medium containing
kanamycin (50μg/ml) at 37℃, and then for 6h at 30℃ with 400μM IPTG. Cells were
harvested by centrifugation, re-suspended in 300μl of 50mM Tris-HCl buffer (pH8.0)
containing 7mM 2-ME, and the bacteria were lysed with an ultrasonic disruptor. Cell debris was
removed by centrifugation. Enzyme assays were carried out as for crude enzyme extracts from
rose flowers.
Northern blot analysis of RhGT1
RNA extracted from sepals, stems, young leaves and mature leaves and five rose developmental
stages were used for northern blot analysis. The coding region of RhGT1 from ‘Crimson Glory’
was labelled with 32P using RediPrimeII DNA labelling kit (Amersham) and used as a probe.
GenBank accession numbers of the GTs; Rauvolfia serpentiana Hydroquinone GT (AJ310148);
Dorotheanthus bellidiformis Betanidin 6-GT (AF374004); Medicago truncatula Triterpene GT
(AY747627); Scutellaria baicalensis Baicalein 7-GluT (AB042277); Phaseolus lunatus Zeatin
GT (AF101972); Zea mays Zeatin GT (AF318075); Vigna angularis ABA GT (AB065190);
Scutellaria baicalensis 7-GT (AB031274); Dorotheanthus bellidiformis Betanidin 5-GT
(Y18871); Gentiana triflora 3’-GT (AB076697); Hordeum vulgare 3-GT (X15694); Zea mays
3-GT (X13501); Dianthus caryophyllus 3-GT (AB191245); Vitis vinifera 3-GT (AF000371);
Gentiana triflora 3-GT (D85186); Perilla flutescens 3-GT (AB002818); Petunia hybrida 3-GT
(AB027454); Solanum melongena 3-GT (X77369); Zea mays IAA GT (L34847); Citrus unshiu
Limonoid GT (AB033758); Eucalyptus perriniana Monoterpene GT (AB166766); Petunia
hybrida 5-GT (AB027455); Varbena hybrida 5-GT (AB013598); Perilla flutescens 5-GT
(AB013596); Torenia hybrida 5-GT (AB076698); Citrus maxima RhaT (AY048882); Petunia
hybrida RhaT (X71059).
Reference
1. Chang, S., Pryear, J. & Cairney, J. Plant Mol. Biol. Rep. 11, 113-117 (1993)