Detailed Material and Methods
Fly stocks
Wild type (WT) embryos were from yw and OreR stocks. ubi-E-cad-GFP (II) homozygous
flies express a functional E-cadherin-GFP fusion (from H.Oda). Overexpression experiments
resulted from crosses of females bearing the 67;15 driver (mat Tub-gal4 VP16 (67c) ; mat
Tub-gal4 VP16 (15)) with males carrying the following constructs : GUS-btsz2 (II), GUSbtsz2Glu (II) (also called btsz2Glu3’UTR in Fig.S2d or btsz2-poly in ref24, UAS-btsz3 (III)
(from J. Serano), UAS Ezrin1-280, also called UAS-EzrinDN (gift of Emiko Suzuki), UASC2AB-HA, UAS-btsz2-C2HA. A ru1 klarsicht1 fly stock (from M.Welte) was used for
injected embryos shown in figure 2 to better reveal the gastrulation defects.
The following btsz mutant stocks were used: w;;btszK13-4/TM3Sb KrGal4-UASGFP and
w;;FRT82B btszJ5-2/ TM3Sb KrGal4-UASGFP. Df(3R)Exel6275/TM3Sb (Bloomington 7742)
flies were used to delete the btsz locus (88D4-5)(confirmed by genomic PCR, not shown).
Btsz deletion constructs:
UAS-C2AB-HA: Three copies of the hemagglutinin epitope HA
(GYPYDVPDYAYPYDVPDYAYPYDVPDYA) were fused to the N-terminus of the Btsz2
C2A and C2B domains (amino acids 2299 to 2645) by cloning the corresponding btsz2 cDNA
fragment (nt 6923 to the end; AY229970 in genebank) in a pUAS-HA3-T vector. The aa
sequence of the fusion is: …VPDYAEFEGRYGT… (HA sequence in bold letters, Btsz2
sequence underlined).
UAS-btsz2-C2-HA: The 5’-part of the btsz2 cDNA (nt 1 to 6849; AY229970), deleted for
the C2A and C2B boxes (aa 2276 to 2645 of Btsz2), was inserted in frame before 3 copies of
the HA epitope. The cDNA btsz2-C2-HA was cloned into the pUAS-T vector. The aa
sequence of the fusion is: …AMHQFYPYDV… (Btsz2 sequence underlined, HA sequence in
bold letters
Northern blots:
PolyA+ mRNAs from a 0-5 hours egg collection at 25° were purified using the Fast Track 2.0
mRNA isolation kit (Invitrogen). 10µg of PolyA+ mRNAs per well were loaded on a
denaturing formaldehyde 1% agarose gel, run in MOPS buffer and transferred by gravity,
after partial RNA Alkaline hydrolysis, on Hybond-N+ Nylon membranes (Amersham).
bitesize transcripts were revealed with 32P-dCTP single stranded cDNAs probes. Probes of
similar sizes named (A-D) are drawn on different exons, and presented according to their
position on the btsz locus. Probe A corresponds to the nucleotides 1520 to 1869 of the btsz1
transcript described in ref 20 (AY229969, genebank). Probe B, C and D respectively match
nucleotides 1960-2542, 3102-3449 and 7330-7692 of btsz2 (AY229970). Hybridization and
washing steps are done according to the Church method, with a further wash of 30 min in
0.1xSSC-0.1%SDS. Hybridized probes were revealed overnight using a PhosphoImager
screen (Fujifilm).
Time-lapse recordings :
Confocal time-lapse images were collected using a spinning-disc confocal head (Perkin
Elmer) run by Metamorph software on an inverted microscope (Zeiss). Phase-contrast timelapse images were collected on an inverted microscope (Zeiss) and a programmable
motorized stage to record different positions over time (Mark&Find module from Zeiss). The
system was run with AxioVision software (Zeiss) and allowed the acquisition of large timelapse data sets in mutant or injected embryos.
RNAi experiments
Three dsRNA probes were made using PCR products (gift of R. Paro): CG14858/btsz probe-1
(HFA14982 PCR product); CG9883 (HFA00731) and CG7343 (HFA16231).
All other dsRNA probes were made by PCR amplification of genomic DNA with a pair of
primers containing the sequence of the T7 promoter
(TAATACGACTCACTATAGGGAGACCAC) followed by 23 nucleotides specific of the
genes to target. PCR products were subsequently used as a template for the in vitro RNA
synthesis with T7 polymerase using Ribomax (Promega) or MEGAscript (Ambion) kits. The
dsRNA probes were purified, precipitated, washed and re-suspended in DEPC treated water,
quantified by OD, checked on agarose gel and diluted for injection at standard concentrations
(3-5 M) in DEPC treated water (btsz probes between 3,4 and 4M; shg/e-cad, 3,1M;
baz/Par-3, 4,5M). The amplified sequences were as follows: baz/Par-3 (nucleotides 125-631
of transcript NM 078659, genebank for Baz1 and 743-1224 for Baz2), shg/e-cad (nucleotides
1412-2133 of transcript NM057374, genebank for Shg1 and 2164-2967 for Shg2) and btsz
sequences (btsz2 transcript AY229970, genebank): probe 1: 3065-3556; probe 2: 3102-3449;
probe 3: 3102-3422; probe 4: 3440-3732, probe 5: 3710-4333 and probe 6 (3”UTR): 79668590. Control dsRNA probes were targeted against CG9883, which is expressed in early
embryos (nt 534-1022); and against CG7343, a putative exon within the btsz locus which is
not expressed in early embryos, based on northern blots and RT-PCR.
We used the following primers (underlined sequences correspond to the T7 promoter):
Baz1T7-F : T7seq AGTACGAAATGAAGGTCACCGTC
Baz1T7-R : T7seq TTTGTTACTGCCCTCTGCCTTCA
Baz2T7-F : T7seq GTCATCAGCTAAAGGAACAGCTG
Baz2T7-F: T7seq CCATTGATCTCCAAGATGCGATC
Shg1T7-F : T7seq TTCAAGATTGACAAGGAGTCGGG
Shg1T7-R : T7seq CGTTATAGAAATCGCGTTCCTCG
Shg2T7-F: T7seq GAGTCTCTTTGATAATGGCGAGC
Shg2T7-R: T7SEQ GGTTTCCATCGTTCTGGTGAATC
btsz probes:
probe1-T7-F : T7seq TAACAACAACGACGGCGAACTTG
probe1-T7-R : T7seq AATCGCCAGCTGCACTTTCATTG
probe2-T7-F T7seq AACAACAACGACGGCGAACTTG
probe2-T7-R T7seq AATCGCCAGCTGCACTTTCATTG
probe3-T7-F T7seq TAACAACAACGACGGCGAACTTG
probe3-T7-R T7seq TGTTGATCATGACCAAACTGCGA
probe4-T7-F T7seq CTGGCGATTACGAAATGGCAAAC
probe4-T7-R T7seq TTGCTGAGATCTTCGTCCTCATC
probe5-T7-F T7seq ATGAGGACGAAGATCTCAGCA
probe5-T7-R T7seq GGCTCTTACCAGTCGCTTTCT
probe6 -T7-F T7seq GGCCAAGTTAGTTTAGGACCAGG
probe6 -T7-R T7seq TGTTATTTGTATTTCTCGGGTAT
control1 (CG9883)-T7-F T7seq CCGCCTCCCATAATAGTCA
control1-(CG9883)-T7-R T7seq TGATGGGCTGTGATCTGG
control2-(CG7343)-T7-F T7seq CACCGTCACCCGTTCCT
control2-(CG7343)-T7-R T7seq AAAGGAGCTATCAGGATTATTG
Embryos were collected from 30 min egg collections at 25°C for WT stocks (or expressing EcadGFP) and from 1h egg collections at 18°C for embryos laid by 67;15 females crossed to
males carrying UAS transgenes. Embryos were dechorionated in 50% bleach, thoroughly
rinsed with water, aligned on agar, stuck on cover slips covered with heptane-glue, dessicated
for a few minutes and covered with Halocarbon 200 oil. Embryos were then injected with
dsRNA or DEPC treated water and stored at RT until recording or fixation.
Except for Figure 1, all btszRNAi experiments use probe 1.
Morpholino injections:
Translation-blocking morpholino antisense oligonucleotides, synthesized by Gene Tools
(Oregon) were used to knock-down the different btsz isoforms. These translation-blocking
morpholinos (Pol AUG MO) are complementary to a region spanning the translation start site
of the 3 bitesize transcripts (-1 to +21/ATG). Sequences were as follows :
btsz0-MO :
5V- TCCCATTCCGGGCATGGTGTTCATG -3V
btsz2-MO :
5V- TCGGGCTGTAGTATAGGCAATCATG -3V
btsz3-MO :
5V- ACTTTCATTGTCTTTGTTGATCATG -3V
A standard negative control morpholino provided by Gene Tools was used, 5VCCTCTTACCTCAGTTACAATTTATA-3V.
Morpholinos were resuspended in water at 1 mM except for the control (2mM). Early
embryos were injected and recorded as for RNAi. The control was injected at 2mM yielding a
20-40µM final MO concentration and btsz specific morpholinos were injected at 0.33mM
each (3-6µM final). When btsz0-MO, btsz2-MO and btsz3-MO were pooled the total
concentration was thus 1mM (10-20µM final).
Chemicals injection
Neomycin (Sigma) was prepared as a 500mM stock in water and injected at 40 mM during
cellularisation. Control embryos were injected with Na2SO4 at 120mM.
RT-PCR
RNAi efficiency was estimated by measuring endogenous mRNA levels using RT-PCR after
injection of the dsRNA probe2 against btsz. Total RNA extraction from early gastrulating
embryos, retro-transcription and PCR reactions were as in Ref14. We used the following RTPCR primers to amplify different regions: exon1-exon6 present in btsz0 and btsz1
(nucleotides 111-2669 of btsz0 and btsz1 transcripts with E1-F,
TCATTCCGTCTACCTGTGCCT, and E6-R, TCCAGGATATCAGCCAGAGGA), exon8
which is present in all isoforms except btsz1 (nt 2247-3731 of btsz2 with E8-F,
AGCTGGCCAACTGCATTGTAG, and E8-R, TGCTCACGAGTTCCGTTGGTT) and the
3’UTR common to all isoforms (nt 5022-6904 of btsz2 with E9-F,
CCAATGCACAGCAGAGCAAGC, and E11-R, CTCTACTTGACCCTTGACCAC).
Control primers amplified actin42 with actin42-F (ACTCCTACATATTTCCATAAA) and
actin42-R (CTCCAGGGACGAGCTTGAA). PCR were performed on different sample
dilutions for control and RNAi embryos, with 30 amplification cycles. In these conditions, the
amount of PCR products correlated with the cDNA input. cDNA contents between control
and RNAi embryos were normalized to actin 42A PCR products. A 4-fold depletion of btsz
transcripts was observed in btsz RNAi embryos compared to control embryos in all RT-PCR
experiments.
Immunofluorescence and chemofluorescence stainings
All embryos were fixed in 3,7% paraformaldehyde and post-fixed in methanol using standard
protocols. However, for Neurotactin antibody stainings, embryos were heat-fixed as described
elsewhere44. For phalloidin stainings the embryos were hand-devitelinized in BBT (PBS,
0,1%BSA, 0,1%Tween20, 0,01%NaN3) to avoid exposure to methanol.
We used probe 1 for all immunostainings of btszRNAi embryos. Injected embryos were
prepared for fixation as described elsewhere44. The following antibodies were used: rat
DCAD2 anti DE-cadherin (1:50, Developmental Studies Hybridoma Bank (DSHB)), rabbit
anti Moesin (1:500, D.Kiehart), rabbit anti PatJ (1:300; H. Bellen and M. Bhat), rabbit anti
Bazooka (1:1000, A.Wodarz), mouse 12CA5 anti HA (1:200, Roche), rabbit phosphoEzrin/Radixin/Moesin (1:50, Cell Signaling Technology) recognizes Drosophila Moesin45,
mouse BP106 anti Neurotactin (1:50, DSHB), mouse GLU-GLU monoclonal Ab anti poly tag
(1:500, Covance Research Products). Secondary antibodies were usually Alexa 488 and Alexa
546. GLU-GLU monoclonal antibody was amplified by an anti mouse biotinylated Ab and
revealed by a Alexa 488 streptavidin conjugate. For the triple Moe, btsz-2Glu and DE-cad
staining, Jackson TRICT, FITC and Cy5 secondary antibodies were used. TRITC-phalloidin
(Sigma) was used at 1:500 for 20 min to label F-actin. Hoechst 33258 (Sigma) was used at
1:500 for 20 min. All confocal images were obtained on a Zeiss LSM510 laser scanning
microscope using a 40X C-Apochromat water immersion objective (NA: 1.2).
Whole mount in situ hybridization:
Whole mount in situ hybridizations were performed following standard procedures with sense
and antisense DIG-labelled DNA probes. Probe A corresponds to the nucleotides 1520 to
2018 of the btsz0 and btsz1 transcripts (AY229969, genebank). Probe B, C and D respectively
match nucleotides 1960-2569, 3102-3468 and 7330-7692 of btsz2 (AY229970).
Yeast Two-Hybrid assay
The sequence corresponding to Btsz2 MBD-C domain (aa 581-863) was cloned into the
pBTM116 vector, the sequence of the Moesin FERM domains (MoeFFF, amino acids 1-300)
was cloned into the pACT2 vector. pACT2-MoeFF (amino acids 8-207) and pACT2-Moe-C
(amino acids 209-575) were a gift from A. Le Bivic. pBTM116-btsz2-MBD-C and pACT2
constructs were co-transfected in L40 yeast cells. Co-transformants were plated in -Leu, -Trp,
-His medium with 50mM 3-aminotriazol. -galactosidase assays were done in liquid culture
using ONPG according to the Yeast protocol handbook from BD Biosciences Clontech.
GST fusion proteins were obtained by cloning the sequence corresponding to the Btsz2
C2AB boxes (amino acids 2299 to 2645) into the pGEX-4T3 vector. The sequence
corresponding to Btsz2 MBDC (Moesin Binding domain and Coiled-coil, amino acids 581863) was cloned into the pGEX-6P1 vector. GST-MoeFFF was obtained by cloning the
sequence of the FERM domains (amino acids 1-300) of Moesin variant D (AAF46415,
genebank) into the pGEX-5X2 vector. All constructs were sequenced.
GST pull down
Transfected S2 cells were washed in cold PBS and lysed in buffer A (1% NP-40, 50mM Tris
pH 7.5, 10mM EDTA, 3mM MgCl2 supplemented with pepstatin, leupeptin and antipain
1µg.ml-1, benzamidine 15µg.ml-1, 1mM sodium orthovanadate and 5mM sodium
pyrophosphate). The lysates were clarified by centrifugation, incubated with 50-70µg of GST
and GST fusion protein coated on Gluthatione Sepharose 4B beads (Amersham Biosciences)
over night at 4°C. After washes, the protein complexes were analysed by Western blot after
SDS-PAGE. For Drosophila embryos, 2-14h WT embryos (250mg) were lysed in buffer A,
and after clarification incubated 1h at 4°C with GST and GST fusion proteins. After washes
the complexes were analysed by western blot after SDS-PAGE. For GST pull down on
embryonic extracts, anti-moesin was preabsorbed on GST-MBDC fusion protein before
immunoblotting at 1:2000. For S2 cells, rabbit anti-D-moesin (gift of D. Kiehart) and mouse
anti-HA (12C5 from Roche, Diagnotics) were used for immunoblotting at 1:20000 and
1:1000 respectively.
Phospholipid binding assays
GST-C2AB and GST were induced in BL21 bacterial strains with 0,3 and 0,6 mM IPTG
respectively for 5h at 30°C. The proteins were eluted from Gluthatione Sepharose 4B beads
(Amersham Bioscience) just before the experiments and quantified by SDS-PAGE. The PIP
strip membranes (Molecular Probes, Invitrogen) were used according to the manufacturer’s
instructions. About 2µg of each GST fusion proteins were incubated over night at 4°C with
the PIP strip membranes and revealed by a rabbit anti-GST antibody (Eurogentec) used at
1:2000. The experiments were done in presence of 1mM CaCl2 or 2mM EGTA in all
solutions.
Cells and transfections
S2 cells were cultured in Insect-Xpress medium (Cambrex) containing 10% FBS and
maintained at 27°C. Cells were co-transfected with pUAS-T constructs and the pMTGal4VP16 (gift of Steve Cohen) vector using Effectene Transfection Reagent (Qiagen)
according to the manufacturer’s instructions. Transfected cells were analysed after 24h of
cDNA expression induced by 0,5 mM CuSO4.
LEGENDS TO FIGURES AND MOVIES
Figure S1: Phenotypes in btszRNAi and btszK13-4/btszK13-4 mutant embryos
Phase contrast images of embryos at different time intervals (dorsal is up, anterior is to the
left). The embryos shown in a-f correspond to the movies M1-M6 in supplemental data
respectively. The embryos are shown at the beginning of gastrulation (T=0), 20 and 40
minutes later. The black arrowheads indicate the position of the posterior end of the embryo
during gastrulation as it moves dorsally and anteriorly during germ-band elongation. The
white arrowheads in f point to irregularities of the epithelium.
Figure S2: Phenotypes in btsz RNAi embryos, mutants and morphants.
a. Phenotypes caused by RNAi using different btsz specific probes at different concentrations
and control probes. b. Organization of the btsz locus showing the different isoforms and the
localization of the dsRNA probes used. The bracket indicates the deleted sequence in the
btszK13-4 allele. The arrowhead shows the position of the stop codon in btszJ5-2. c. Northern
blot with the different probes shown in b. (probes A-D). Probe C matches the same sequence
as probe 2 used for RNAi in a. d. Defects in btszRNAi embryos with a 3’UTR specific probe
(probe 6 in b.) and rescue in embryos expressing btsz2Glu without 3’UTR sequences. e.
Defects observed in embryos injected with either control morpholinos or with a mix of
morpholinos specific to btsz0, btsz2 and btsz3. Injection of morpholinos against btsz2 alone is
also shown. f. Phenotypes observed in embryos coming from btszK13-4/btszK13-4 females
with different zygotic genotypes. “mat” and “zyg” denote the maternal and zygotic genotypes
respectively.
Figure S3: in situ hybridization with btsz probes.
The DIG labelled antisense probe C, which recognizes all three btsz isoforms and corresponds
to the RNAi probe 2, reveals a maternal (a) and zygotic (b-d) expression from cellularisation
(b) to the beginning (c) and end (d) of gastrulation. A control sense probe does not reveal any
expression (e-h). Probe B recognizes btsz0 and btsz2 but not btsz3 and reveals likewise a
maternal (i) and zygotic (j, k) expression. Control sense probe is shown in l-n.
Figure S4: RT-PCR in btszRNAi embryos.
RT-PCR was performed as described in material and methods to amplify 3 different
fragments: exon1-6 present in btsz0, exon8 and 3’UTR present in btsz0, btsz2 and btsz3. We
used water injected and btszRNAi embryos with different amounts of template (relative
amounts 1, ½ and ¼). A control RT-PCR amplified a fragment in actin42A. Note the strong
down-regulation of btsz in btszRNAi embryos.
Movies1-6: All movies show time lapse sequence of embryos recorded in phase contrast
microscopy at 2 minutes intervals for 60-80 minutes. The movies begin around the end of
cellularisation. When gastrulation begins, the posterior midgut at the posterior tip (marked
with an orange dot to the right) moves anteriorly. This movement is normal in control
embryos (Movies M1 and M5) but affected in mutants due to a collapse of the epithelium.
Movie M1: control RNAi embryo (control 1 probe)
Movie M2: btszRNAi (probe2) embryo with a strong phenotype (red category in Fig.S2a)
Movie M3: btszRNAi (probe2) embryo with a medium phenotype (orange category in
Fig.S2a)
Movie M4: btszK13-4 mat-/-, zyg+/- mutant embryo without phenotype (blue category in
Fig.S2f)
Movie M5: btszK13-4 mat-/-, zyg-/- mutant embryo with a strong phenotype (red category in
Fig.S2f).
Movie M6: btszK13-4 mat-/-, zyg-/- mutant embryo with a medium phenotype (red category
in Fig.S2f).
Movie M7: Confocal time lapse series showing E-cad-GFP at 15” intervals in a btszRNAi
embryo. The movie begins at the onset of gastrulation and lasts about 11 minutes. The label
marks AJs. Note that AJs form normally but that the E-cad-GFP levels drop dramatically
within a few minutes.