Supporting information
Supporting materials and methods
Vector constructions
The miR-10a sequence was amplified and inserted into pcDNA3.
pRNAT-U6.2/Lenti-antagomir-miR-10a (anti-miR-10a), which was used as the inhibitor of
miR-10a according to a previous report 1, was constructed in our earlier research. miR-10a
antisense oligonucleotides (ASO-miR-10a) was also used as the inhibitor of miR-10a and
ASO-NC was used as its control. The EGFP coding region from the pEGFP-N2 vector was
subcloned into pcDNA3. The wild-type or mutant EphA4 3’-UTR was then cloned into the
pcDNA3-EGFP vector. The pSilencer/shR-EphA4 vector was constructed by annealing the top
and bottom strands of hairpin RNA and inserting them into the pSilencer2.1 neo vector
(Ambion). The EphA4 expression vector, pA3M1-EphA4, was constructed by cloning the coding
sequence of EphA4 into pA3M1 (pcDNA3-myc-tagged at the N-terminus). All the
oligonucleotides used are shown in Supporting table 1.
Drug selection
QGY-7703 or HepG2 cells were placed into cell culture flank (250 ml) containing G418
(Geneticin, 1mg/ml or 500μg/ml) 24 h after transient transfection with pcDNA3-pri-10a, pcDNA3,
pRNAT-U6.2/Lenti-anti-miR-10a and pRNAT- U6.2/Lenti vectors. The medium was changed
every three days. 9 days later, many G418-resistant colonies grew. Total RNAs were prepared
and used for real-time RT-PCR analysis. We obtained transformed cells that were resistant to
G418, and eight stable cell lines, QGY-7703/miR-10a, QGY-7703/Ctrl, QGY-7703/anti-miR-10a,
QGY-7703/NC, HepG2/miR-10a, HepG2/Ctrl, HepG2/anti-miR-10a, and HepG2/NC were
generated.
MTT assay
The HepG2 and QGY-7703 cells (8,000 cells / well) were placed in 96-well plates. At 24 h
following transient transfection, the cells were continually cultured for 24-72 h. At 24, 48 and 72
h, 10 μl of 0.5 mg/ml 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyl-tetrazoliumbromide (MTT) was
added to each well. The cells were incubated at 37℃ for another 4 h, the medium was removed
and the precipitated formazan was dissolved in 100 μl of DMSO. After shaking for 20 min, the
absorbance was detected at 570 nm (A570) on a μQuant Universal Microplate
Spectrophotometer (Bio-Tek Instruments, Winooski, USA). This experiment was also carried
out in stable QGY-7703 cell lines.
Colony formation assay
HepG2 or QGY-7703 cells were trypsinized, and 100 cells / well were placed in a 24-well plate
24 hours after transient transfection. The cells were cultured for 14 days, and the culture
medium was replaced every 3 days. The cloning efficiency was calculated using the following
formula: cloning efficiency (%) = (the number of cell clones / the number of inoculated cells) ×
100. A colony required a minimum of 50 cells to be counted. Experiments were performed in
triplicate. The same experiment was repeated using the stable QGY-7703 cell lines.
Quantitative real-time PCR (qRT-PCR)
mRNAs or miRNAs were reverse transcribed to generate cDNA using oligo-dT primers or
stem-loop reverse transcriptase (RT) primers, respectively. U6 snRNA and the β-actin
housekeeping gene were used as the endogenous control for miRNA and mRNA, respectively.
The primers used in this study are shown in Supporting table 2.
Western blot analysis
Cell lysates were separated on 8% SDS denatured polyacrylamide gel electrophoresis (PAGE)
gels,
transferred
to
nitrocellulose
membranes
and
blocked
in
phosphate-buffered
saline/Tween-20 containing 5% nonfat milk. The membranes were incubated with antibodies
against EphA4 (1:300 dilution), E-cadherin (1:100 dilution), Vimentin (1:100 dilution), ICAM-1
(1:50 dilution),β1-integrin (1:100 dilution) or glyceraldehyde phosphate dehydrogenase
(GAPDH) (1:500 dilution) overnight at 4℃. Membranes were then incubated with the
HRP-labeled corresponding IgG for 2h. Protein expression level was assessed by enhanced
chemiluminescence and exposure to film (Fujifilm, Tokyo, Japan). Lab Works Image Acquisition
and Analysis Software (UVP) were used to quantify band intensities. Antibodies were
purchased from Tianjin Saier Biotech (Tianjin, China). All assays were performed in triplicates.
Migration and invasion assays
For the transwell migration assay, transfected cells were trypsinized, and 5×10 4 QGY-7703 cells
or 15×104 HepG2 cells were placed in the upper chamber of each insert (Corning, Cambridge,
USA) containing the non-coated membrane. For the invasion assay, 5×10 4 QGY-7703 cells or
12×104 HepG2 cells were placed on the upper chamber of each insert coated with 40 μl of
matrigel (Clontech, Mountain View, CA), which was diluted to 4μg/μl with RPMI 1640 medium
for QGY-7703 cells or 1μg/μl with MEM-αmedium for HepG2 cells. Medium supplemented with
20% fetal bovine serum (800 μl) was added to the lower chambers. After several hours of
incubation at 37℃ (9 hours for QGY-7703 and 24 hours for HepG2 in the migration assays; 12
hours for QGY-7703 and 72 hours for HepG2 in the invasion assays), the upper surface of the
membrane was wiped with a cotton tip and cells attached to the lower surface were stained for
20 min with crystal violet. Cells in five random fields of view at 100× magnification were counted
and expressed as the average number of cells per field of view. All assays were performed in
triplicates.
Immunohistochemical staining
All of the tissue samples were fixed in phosphate-buffered neutral formalin, embedded in
paraffin, and cut into 5-µm-thick sections. Tissue sections were deparaffinized, rehydrated, and
microwave-heated in sodium citrate buffer for antigen retrieval. The sections were then
incubated with 0.3% hydrogen peroxide/phosphate-buffered saline for 30 min. Sections were
incubated with a primary antibody against EphA4 at a 1:50 dilution and incubated overnight at
4℃. Detection of the primary antibody was performed using goat anti-rabbit-HRP for 1 hour at
room temperature and visualized with DAB substrate.
Immunofluorescence staining
Transfected QGY-7703 cells (4,000/well) were placed into 14-well plates. After 24 h, cells were
rinsed in PBS and fixed with paraformaldehyde at 4℃ for 30 min. After rinsing in PBS, cells
were incubated with 10% normal donkey serum for 30 min to block non-specific
immunoglobulin binding sites. Cells were then incubated with a primary antibody (E-Cadherin,
rabbit) (1:50 dilution) at 4℃ overnight. A fluoresceinisothiocyanate (FITC)-conjugated goat
anti-rabbit IgG (1:100 dilution) secondary antibody was added, and cells were incubated for 1.5
hours in the dark at room temperature. Nuclei were labeled with 4’,6-diamidino-2-phenylindole
(DAPI) (1:1,000 dilution). All images were captured using a fluorescence microscope (model
Eclipse 660, Nikon, Japan) and a digital camera (ACT-2U, Nikon, Japan), and the NIS Element
FW software package.
Supporting references
1.
Cui YH, Xiao L, Rao JN, Zou T, Liu L, Chen Y, Turner DJ, Gorospe M, Wang JY. miR-503
represses CUG-binding protein 1 translation by recruiting CUGBP1 mRNA to processing
bodies. Mol Biol Cell 2011;23:151-62.
Supporting figure legends
Supporting Fig. 1. The efficiency of the pcDNA3-pri-10a and ASO-miR-10a plasmids.
QGY-7703 cells were transfected with pcDNA3-pri-10a and ASO-miR-10a. qRT-PCR was used
to detect the mRNA level of miR-10a. The construction of the two plasmids was successful.
**P<0.01.
Supporting Fig. 2.
Ectopic expression of miR-10a shows no obvious impacts on cell
growth and proliferation in vitro. (A and B) MTT assays of QGY-7703 and HepG2 cells that
were transiently transfected with pcDNA3-pri-10a, ASO-miR-10a or a control vector. (C and D)
Colony formation assays of transiently transfected QGY-7703 and HepG2 cells. All data were
analyzed in three independent experiments. Cloning efficiency (%) = (the number of cell clones
/ the number of inoculated cells) × 100. Data represent the means of three separate
experiments ± S.D.
Supporting Fig. 3. miR-10a promotes HCC cell migration and invasion in vitro.
(A) Transwell migration assay of QGY-7703 and HepG2 cells. (B) Transwell invasion assay of
QGY-7703 and HepG2 cells. The representative images were shown. Cells in five random
fields of view at 100× magnification were counted.
Supporting Fig. 4.
Relative expression level of miR-10a in several HCC cells. We
detected the miR-10a expression level in PLC-PRF-5, Hep3B, QGY-7703 and HepG2 cells.
Data represent the means of three separate experiments ± S.D.
Supporting Fig. 5.
The identification of QGY-7703 and HepG2 pooled clones. (A and B)
qRT-PCR was used to detect the mRNA level of miR-10a in QGY-7703 pooled clones. (B)
qRT-PCR was used to detect the mRNA level of miR-10a in HepG2 pooled clones.
***P<0.001.
Supporting Fig. 6. miR-10a promotes migration and invasion but does not affect cell
viability and proliferation of the QGY-7703 pooled clones. (A) MTT assay of the
QGY-7703 pooled clones. (B) Colony formation assay of the QGY-7703 pooled clones. Cloning
efficiency (%) = (the number of cell clones / the number of inoculated cells) × 100. Data
represent the means of three separate experiments ± S.D. (C) Transwell migration assay of the
QGY-7703 pooled clones. (D) Transwell invasion assay of the QGY-7703 pooled clones.
Representative images are shown on the left. Cells in five random fields of view at 100×
magnification were counted and expressed as the average number of cells per field of view.
**P<0.01.
Supporting Fig. 7. Blockage of miR-10a can promote HCC metastasis in vivo. The number
of mice in which primary tumors and intrahepatic metastatic nodules were formed is shown in
the table.
A representative picture of tumor nodules in primary sites (spleen) and metastatic
sites (liver) at the sixth week after spleen transplantation is shown on the left. Quantification of
the metastatic ability of the pRNAT-U6.2/lenti-anti-miR-10a vector or control vector is shown on
the right. The numbers of intrahepatic metastatic nodules in each mouse were counted. **
P<0.01
Supporting Fig. 8. miR-10a is down-regulated in HCC tissues with tumor metastasis.
qRT-PCR was used to detect the relative expression of miR-10a in 22 HCC tissues with venous
invasion or tumor microsatellite formation and 18 HCC tissues without metastasis. Box-plot
lines represent medians and interquartile ranges of the normalized threshold values; whiskers
and spots indicate 10-90 percentiles and the remaining data points. The miR-10a abundance
was normalized to U6.
Supporting Fig. 9. EphA4 can suppress HCC cell migration and invasion in vitro.
(A) Transwell migration assay of QGY-7703 and HepG2 cells.
(B) Transwell invasion assay of
QGY-7703 and HepG2 cells. The representative images were shown. Cells in five random
fields of view at 100× magnification were counted.
Supporting Fig. 10. Like miR-10a, EphA4 does not affect HCC cell growth and
proliferation. (A and B) MTT assays of QGY-7703 and HepG2 cells in which EphA4 was
knocked down. (C and D) Colony formation assays of QGY-7703 and HepG2 cells in which
EphA4 was knocked down. Cloning efficiency (%) = (the number of cell clones / the number of
inoculated cells) × 100. All data were analyzed in three independent experiments.
Representative images are shown.
Supporting Fig. 11. miR-10a and EphA4 regulate HCC cell migration and invasion via
blockage of the EMT process. QGY-7703 cells were transiently transfected with
ASO-miR-10a or pA3M1-EphA4 and their respective control vectors. Panels show the
bright-field morphology of transfected cells (upper panels) and the immunofluorescence for the
adherent junction marker, E-Cadherin (green, second panels). Nuclei were stained blue with
DAPI (blue, third panels). The scale bar represents 100 µm.
Supporting Fig. 12.
migration and invasion.
Restoration of EphA4 inhibits miR-10a-mediated HCC cell
(A) Transwell migration assay of QGY-7703 cells with or without
EphA4 restoration. (B) Transwell invasion assay of QGY-7703 cells with or without EphA4
restoration. The representative images were shown and cells in five random fields of view at
100× magnification were counted.
Supporting figures
Supporting tables
Supporting table 1 The oligonucleotides used in vector constructions
Name
Oligonucleotides Sequence
pri-miR-10a sense
5’- GATTCGGATCCCAAGAACAGACTCGCAC -3’
pri-miR-10a antisense
5’- GGGAGAATTCGGGGAGAGTTCAGGTAGATG -3’
ASO-miR-10a
5’- CACAAAUUCGGAUCUACAGGGUA-3’
ASO-NC
5’-CAGUACUUUUGUGUAGUACAA-3’
EGFP sense
5’-GCAGCCAAGCTTGCCACCATGTGTAGCAAGGGC-3’
EGFP antisense
5’- CGCGGATCCTTTACTTGTACAGCTCGTCC -3’
EphA4-3’UTR sense
5' - ATGGATCCTGTTGCCCTCAC -3'
EphA4-3’UTR antisense
5' - CAGAATTCCTCCTACCCTTACC -3'
EphA4-3’UTRmut sense
5' - TATTACATTCTGTCTGCGAGTGTGGCATTG -3'
EphA4-3’UTRmut antisense 5' - CAATGCCACACTCGCAGACAGAATGTAATA -3'
EphA4-siR-Top
GATCCGAGCGTTTCATCAGAGAGATTCAAGAGATCT
CTCTGATGAAACGCTCTTTTTTGGAAA
EphA4-siR-Bottom
AGCTTTTCCAAAAAAGAGCGTTTCATCAGAGAGATC
TCTTGAATCTCTCTGATGAAACGCTCG
The underlined sequences indicate the restriction enzyme sites.
Supporting table 2 The primers used in qRT-PCR
Name
miR-10a RT primer
Primer Sequence
GTCGTATCCAGTGCAGGGTCCGAGGTATT
CGCACTGGATACGACCACAAATTC
U6 RT primer
GTCGTATCCAGTGCAGGGTCCGAGGTATT
CGCACTGGATACGACAAAATATGGAAC
miR-10a forward
5’-TGCGGTACCCTGTAGATCCG -3’
U6 forward
5’-TGCGGGTGCTCGCTTCGGCAGC -3’
Reverse
5' - CCAGTGCAGGGTCCGAGGT -3'
EPHA4 forward
5' - ATGGATCCTGTTGCCCTCAC -3'
EPHA4 reverse
5'- CAGAATTCCTCCTACCCTTACC -3'
β-actin forward
5'- CGTGACATTAAGGAGAAGCTG -3’
β-actin reverse
5'- CTAGAAGCATTTGCGGTGGAC -3’