Supplemental material
Results and discussion
Assay development and validation. To evaluate the specificity of annealing of SMN1 and SMN2 probes,
we have analyzed cDNA samples from patients and from individuals with SMN2 homozygous deletion.
No aspecific PCR products were observed in both cases, indicating that SMN1 and SMN2 probes are
strictly specific (data not shown). The efficiency of PCR reactions was very similar for SMN1-fl,
SMN2-fl and GAPDH, as demonstrated by the average slope of standard curves (-3.33±0.10, -3.27
±0.09 and -3.37±0.10 for SMN1-fl, SMN2-fl, and GAPDH transcripts, respectively). The reliability of
each amplification was high: the mean correlation coefficient was 0.993±0.004, 0.995±0.003,
0.993±0.005, for SMN1-fl, SMN2-fl and GAPDH, respectively.
The reproducibility of the assay was tested for SMN1-fl, SMN2-fl and GAPDH transcripts by
calculating the coefficient of variation (CV) of repeated amplifications of the same samples, both in the
same PCR and in different reactions. The average CV, calculated for all samples analyzed, was 0.14
(+0.06) for the three amplicons. Moreover, we analyzed the reproducibility of RT-PCR reactions by
quantifying SMN2-fl and GAPDH transcript levels of three patients in two different cDNA synthesis.
The mean CV was 0.05 (+0.03) and 0.06 (+0.06), respectively.
SMN-fl levels can be reliably determined as sum of SMN1-fl and SMN2-fl. In controls and carriers
included in the present study, SMN-fl levels have been calculated as sum of SMN1-fl and SMN2-fl. To
validate this approach, we have developed a supplemental assay suitable for the quantification of full
length transcripts of both SMN1 and SMN2 genes. We have followed the same strategy as reported in
Materials and methods section for SMN1-fl, SMN2-fl and GAPDH. In particular, a SMN full length
cDNA fragment was amplified by using the primers SMN-12fl_exst-F (5’ – ttatatgggtttcagacaaaatc -3’)
and SMN-12fl_exst-R (5’ – agatctgtctgatctttcttta – 3’), located in exon 7 and 8, respectively. Primers
for real time PCR were : SMN-12fl_abs-F (5’ – aaaaagaaggaaggtgctcacatt – 3’) and SMN-12fl_abs-R
(5’-tggtgtcatttagtgctgctctatg -3’), located in exon 7 and 8, respectively. The MGB probe, located at
exon7/8 junction was SMN-12fl_abs-P (5’-FAM-cttaaattaaggagaaatgc-MGB-3’). SMN-fl transcript
levels were determined in RNA samples from 6 control individuals, both as SMN1-fl plus SMN2-fl and
with the single primers/probe pairs indicated above. The results are summarized in Supplemental table
2. The results obtained with the different probe sets were analysed by using a linear regression model
by which we could demonstrate that SMN-fl levels as determined by both assays are strikingly similar
(correlation coefficient=0.98, p=4*10-4). Also when comparing the results obtained with the two
different approaches, using different statistical tests for paired samples, both parametric and non
parametric, we always obtained non significant p-value (p>0.67).
SMN-fl levels in carriers and controls. The variation observed in SMN1-fl levels in repetitive samplings
of controls remains unexplained since the fine regulation of the SMN locus is largely unknown: to our
knowledge, only 4 kb of the promoter region have been studied so far. Interestingly, as shown in the
study of Monani et al.1, SMN1 promoter has a 2-fold higher activity compared to SMN2, albeit
strikingly similar nucleotide sequence. An alternative hypothesis is that differences in the
transcriptional activity of SMN1 and SMN2 genes may be ascribed to cis-acting elements located distant
from the genes2.
To evaluate whether SMN1-fl transcript levels are affected by SMN1 gene dosage effect, we compared
SMN1-fl levels in controls and carriers, and observed no statistically significant differences between the
two groups (MW and KW p=0.88, see supplemental table 1 and supplemental fig. 2A), suggesting that
SMN1-fl transcript levels are not related to gene dosage, and that the single SMN1 gene in carriers is
presumably up-regulated in order to compensate the absence of the trans-allele. Subsequently, to assess
whether the absence of one SMN1 allele in carriers modifies the expression of the SMN2 genes, we
compared SMN2-fl levels in the two groups, and observed lower mean and median levels in controls
(table, supplemental fig. 2B), although this difference was not statistically significant (MW and KW
p=0.08). It is unlikely that this finding is related to a difference in the number of SMN2 genes, since in
our group of carriers the modal and median number of SMN2 copies is two, similar to previously
2
reported data for controls3. When SMN1-fl and SMN2-fl were considered together, SMN-fl levels were
slightly higher in carriers compared to controls, likely due to the higher SMN2-fl levels (Supplemental
table 1, supplemental fig. 2C). However, this difference was not statistically significant (MW p=0.44).
No statistical differences were observed between sexes (MW: p=0.38 controls M vs. F; p=0.90 carriers
M vs. F).
SMN2-fl are related to SMN1-fl levels in carriers and controls. To evaluate whether SMN1 may affect
the expression of SMN2 genes in controls and carriers, we applied a linear regression model indicating
SMN1-fl as independent variable. We obtained two different expressions for controls and carriers
(supplemental fig. 3A and B, respectively) which describe the correlation between SMN1-fl and SMN2fl transcripts, at 95% confidence level:
carriers: SMN2-fl = 19,3386 + 0,544947*SMN1-fl (ANOVA p=0.017)
controls: SMN2-fl = 9,4481 + 0,411474*SMN1-fl (ANOVA p<10-5)
However, while in controls a correlation coefficient of 0.81 was obtained, indicating a moderately
strong correlation between the two variables, in carriers the correlation coefficient was 0.48, suggesting
that in this group the correlation between the two variables was much weaker. This finding cannot be
ascribed to PCR efficiency or to quality of RNA samples, since the same regression model, used to
compare GAPDH vs. SMN1-fl or SMN2-fl transcripts in carriers and controls, showed no significant
correlations (one way ANOVA p>0.38). Our data suggest that SMN1 and SMN2 genes may share some
common regulatory elements which are maintained in individuals with intact SMN locus, whereas the
co-regulation might be lost in carriers due to the deletion of one SMN1 allele.
SMN2-fl levels in patients and controls. To gain insight into the regulation of SMN2 expression in the
absence of SMN1 genes, we considered SMN2-fl levels only of controls and compared to those of
patients group. Surprisingly, we found significantly higher transcript levels in patients (MW: p=0.001;
KW ANOVA: p=5.4*10-4, table 1, supplemental fig. 4). When subgrouped on the basis of the clinical
3
phenotype, the difference was significant between type III patients and controls (MW: p=5.3*10-4; KW
ANOVA: p= 5.0*10-4), but not between type II patients and controls (MW: p=0.20, KW ANOVA:
p=0.19). To assess whether this difference may be ascribed to the number of SMN2 genes, we compared
SMN2-fl transcript levels only of type III patients with 3 SMN2 copies to controls, and observed that the
difference between type III and controls was still significant (MW: p=0.005; KW ANOVA: p=0.004).
The difference observed might be due to different SMN2 promoter activation or exon 7 alternative
splicing: an absolute real time PCR assay for SMN-delta7 transcripts could help to address these points.
SMN-fl transcript levels in fibroblast cell cultures. To test whether our assay could be suitable also for
in vitro studies and to assess whether SMN2-fl transcripts are reduced also in SMA primary cells, we
have analyzed SMN-fl transcript levels in four fibroblast cultures, one from a control individual and
three from SMA patients, one per each type. Average transcript levels were 328.55 (+81.55) and 308.40
(+65.82) mol/ng of RNA for SMN1-fl and SMN2-fl transcripts, respectively. SMN-fl transcripts were
636.95 mol/ng of RNA, 6 to 7 folds higher compared to leukocytes. Also in SMA cell cultures, similar
to blood leukocytes, SMN2-fl transcript levels were reduced with respect to SMN-fl of control cells. In
particular, SMN2-fl transcripts were 258.55 (+51.26), 202.95 (+33.44), and 303.16 (+34.34) mol/ng of
RNA, in SMA type I, type II and type III cell cultures, respectively. Type I patient cell culture appear to
have slightly higher SMN2-fl transcript levels compared to type II fibroblasts: this finding is not
particularly unexpected due to the overlapping of SMN2-fl transcript level distribution observed in vivo
among different SMA type.
GAPDH transcripts in controls, carriers, and patients. To rule out that possible variations in SMN-fl
levels in the three groups could be due to PCR artefacts, we have analysed also GAPDH transcript
levels (table, supplemental fig. 5) in controls, carriers and patients. It has been demonstrated by using
absolute real time PCR that GAPDH transcript levels are among the less fluctuating compared to other
housekeeping genes, in different individuals and in different tissues4.
4
No statistically significant differences were observed when comparing the three groups both by
parametric (t-test for independent variables, p>0.39, fig. 5A) and non-parametric tests (MW, p>0.92).
Subsequently, all samples were analyzed as a unique group. The distribution of transcript levels (fig.
5B) could be considered normal both with Lilliefors (p<0.15) and Kolmogorov-Smirnov (p>0.20) but
not with Shapiro Wilks W test (p<0.006). However, when excluding the two highest values, the three
tests gave non significant p values (data not shown), thus suggesting that GAPDH transcripts
distribution can be reasonably considered normal and can be described using mean and standard
deviation.
Finally, we evaluated GAPDH transcripts also in fibroblast cell cultures, in which mean levels were
53702.33 (+13923.38) mol/ng of RNA, 9 to 10 folds higher than that found in blood leukocytes.
References
1.
Monani UR, McPherson JD, Burghes AH. Promoter analysis of the human centromeric
and telomeric survival motor neuron genes (SMNC and SMNT).Biochim Biophys Acta. 1999;
1445:330-6.
2.
Boda B, Mas C, Giudicelli C, et al. Survival motor neuron SMN1 and SMN2 gene promoters:
identical sequences and differential expression in neurons and non-neuronal cells. Eur J Hum Genet.
2004; 12:729-737.
3.
Ogino S, Wilson RB, Gold B. New insights on the evolution of the SMN1 and SMN2 region:
simulation and meta-analysis for allele and haplotype frequency calculations. Eur J Hum Genet 2004;
12:1015-23.
4.
Tricarico C., Pinzani P, Bianchi S, et al. Quantitative real-time reverse transcription polymerase
chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue
biopsies. Analytical Biochemistry 2002; 309:293–300.
Supplemental figure legends:
Fig. 1. SMN-fl transcript levels distribution in controls (A) and carriers (B) and SMN2-fl levels in
patients (C). The black curves indicate the expected normal distribution.
5
Fig. 2. SMN1-fl (A), SMN2-fl (B) and SMN-fl (C) transcript levels in carriers and controls. No
difference was found in SMN1-fl levels in the two groups. SMN2-fl transcripts, as well as SMN-fl, were
slightly higher in carriers.
Fig. 3. Linear regression model between SMN1-fl and SMN2-fl transcript levels in controls (A) and
carriers (B). Dots indicate SMN1-fl levels of each patient and the corresponding SMN2-fl levels; curve
lines indicate the confidence interval.
Fig. 4. SMN2-fl levels in patients and controls. SMN2-fl levels are significantly higher in patients
compared to controls. In type II patients, SMN2-fl levels were slightly higher compared to controls,
whereas the difference was highly significant in the case of type III patients.
Fig. 5. GAPDH transcript levels in controls, carriers and patients. A: No significant differences were
found in the three groups and as a consequence, all samples were considered as single group. B: In
contrast to SMN transcripts, the distribution of GAPDH can reasonably considered be normal. The
black curve indicates the expected normal distribution.
6