1
Supplemental Information
Figure Legends:
Figure 1. Modulation of smooth muscle gene expression by PDGF. A7r5 cells in serum-free medium were stimulated with PDGF-BB (20 ng/ml) for 24 hr in the presence or absence of U0126 (10  m). RNA was isolated and transcripts detected by RT-PCR.
PCR products were quantified by phosphoimager analysis and values expressed relative to the level of expression of each transcript in differentiation medium.
Figure 2. ChIP assay to detect association of myocardin and Elk-1 with the  smooth muscle actin gene promoter. Chromatin was prepared from A7r5 cells under the indicated culture conditions and immunoprecipitated with anti-myocardin (lanes
1-3) or anti-Elk-1 (lanes 4-6), followed by PCR using primers from the SM  -actin promoter. PCR reactions with input chromatin (lanes 7-9) confirmed that equivalent amounts were present in each sample. In the absence of antibody, no signal was detected
(lanes 10-12). ChIP assays of sequences within the coding region of the gene showed no response to PDGF (data not shown).
Figure 3.
Gel mobility shift assays with the CArG and TCF binding sites from the cfos and SM22 promoter. a) Gel mobility shifts were performed using a probe corresponding to the distal
SM22 CArG box, but lacking the adjacent TCF site. Myocardin can form a

2 ternary complex with SRF on this probe, but Elk-1 cannot bind the probe or displace myocardin efficiently. b) Gel mobility shift assays were performed with a radiolabeled probe corresponding to the c-fos serum response element. In the top panel, increasing amounts of myocardin (0.5ul, 2ul, or 5ul) in the absence (lanes 2-5) or presence (lanes 7-10) of a constant amount of Elk-1 (0.3ul) was used. In the middle panel, increasing amounts of Elk-1 (0.1ul, 0.3ul and 1ul) in the absence (lanes 12-15) or presence
(lanes 17-20) of a constant amount of myocardin (3ul) was used. In the lower panel, a probe with a mutation in the TCF site was used. Elk-1 is relatively weak competitor with myocardin for interaction with SRF on this probe. Only the region of the gel containing the shifted probe is shown. c) Gel mobility shift assays were performed as in (a). In lanes 1-4, a probe corresponding to the c-fos serum response element was used. In lanes 5-8, the
TCF site in the probe was mutated. 0.1ul, 0.3ul, 1ul or 3ul of Elk-1 was used in lanes 1-4 and 5-8. The TCF site mutation disrupts binding of Elk-1 but at high concentrations of Elk-1, weak binding can be observed (lane 5-8). d) COS cells were transfected with or without an expression vector for myocardin.
Cells were maintained in 0.5% FBS (-) or treated with 20% FBS (+) for 6 hrs in the presence of absence of U0126. Nuclear extracts from these cells were used for gel shift assays with a probe from the distal SM22 CArG box and adjacent
TCF site or the same probe but with a mutation in the TCF site. The positions of the complexes are indicated. Serum promotes the association of Elk-1 with SRF
(compare lanes 1 and 2) and diminishes the association of myocardin with SRF on

3 the SM22 CArG box (compare lanes 3 and 4). This effect of serum is mediated by the MAP kinase pathway, which is blocked by U0126 (compare lanes 2 and 3, and 4 and 6). The serum effect is also diminished when the TCF site is mutated
(lanes 7-12).
Figure 4. Loss of myogenic activity of myocardin mutant L291P. a) 10T1/2 cells were transfected with the indicated expression vectors and SM-
MHC-positive cells were detected. The relative number of positive cells with myocardin was assigned a value of 100 b) 10T1/2 cells were transfected with the indicated expression vectors and SM22 was assayed by western blot.  Tubulin was detected as a loading control. The
L291P mutant is defective in inducing SM22 expression. c) 10T1/2 cells were transfected with the expression plasmids indicated above each lane. RNA was isolated and transcripts were assayed by RT-PCR. L7 transcripts were detected as a loading control. The L291P mutant is defective in inducing smooth muscle gene expression.
Figure 5. Phosphorylation of Elk-1 in the presence of serum and inhibition by
U0126. COS cells were treated with 0.5% FBS (-) or 20% FBS (+) in the presence or absence of U0126, as indicated. Total Elk-1 protein and phospho-Elk-1 were detected by western blot. Activated ERK-1/2 was also detected with anti-phospho-p42/44. Exposure to 20% FBS induces phosphorylation of Elk-1 and p42/44, indicative of ERK activation.
U0126 blocks serum-dependent phosphorylation.

4
Figure 6. Repression of myocardin transcriptional activity by Elk-1 a) COS cells were transiently transfected with expression vectors for myocardin, and
Elk-1, Elk1-Y159A or Elk-1 ETS and an SM22-luciferase reporter. The amount of each expression plasmid in nanograms is indicated. Values are expressed as fold-activation of the reporter above background. b) COS cells were transiently transfected with expression vectors for myocardin, and
Elk-1, Elk1-Y159A or Elk-1 ETS and 3xSRE-luciferase (upper panel) or
3xSRE-TCFmut-luciferase (lower panel) reporters. The amount of each expression plasmid in nanograms is indicated. Values are expressed as foldactivation of the reporter above background. The 3xc-fos-SRE-luciferase reporter was constructed by linking 3 tandem copies of the c-fos serum response element
(SRE) to a TK-promoter-driven luciferase reporter. To construct the 3xc-fos-
TCFm-SRE-luciferase reporter, 3 tandem copies of the c-fos SRE with the TCF site mutated from GGAT to AAAT were used. Elk-1 blocks the transcriptional activity of myocardin on the wild-type SRE, but its repressive activity is diminished on the promoter lacking a TCF site. Repression by Elk-1 is also diminished by the Y159A and  ETS mutations, which diminish DNA binding activity. However, at high concentrations of input plasmid, the  ETS mutant or
Y159A mutant of Elk-1 can weakly interfere with myocardin activity, which likely reflects the ability of Elk-1 to associate with SRF in the absence of a DNA binding site, as shown in Supplemental Figure 3.

c) 10T1/2 cells were transfected with the indicated expression vectors and SM-
MHC-positive cells were detected. The relative number of positive cells with myocardin was assigned a value of 100.
d) 10T1/2 cells were transfected with myocardin and Elk-1 expression vectors as indicated. SM22 was assayed by western blot.  -Tubulin was detected as a loading control. e) 10T1/2 cells were transfected as in (a). RNA was isolated and transcripts were assayed by RT-PCR. L7 transcripts were detected as a loading control.
Supplementary Methods:
Antibodies. Antibodies were purchased from the following sources: Rabbit anti-SM-
MHC antibody (Biomedical Technologies, Inc.), SM -Actin and  tublin antibodies
(Sigma), rabbit anti-SRF and rabbit anti-Elk1 antibodies (Santa Cruz), rabbit antiphospho-Elk1, rabbit anti-Elk-1, and mouse anti-SRF (Cell Signaling). Rabbit anti-
SM22 antibodies were provided by Dr. Michael Parmacek and Dr. Lucia Schuger.
Gel shift probes. The sequence of the c-fos serum response element probe was:
AGCTTCTTTACACA GGAT GT CCATATTAGG ACATCTGCGTCAGCAA.
The CArG box is in bold and the TCF site is underlined.
The sequence of the cfos-TCFmut probe was:
AGCTTCTTTACACA AAAT GT CCATATTAGG ACATCTGCGTCAGCAA.
5

6
Primers for ChIP assays.
The SM22 promoter contains two essential CArG boxes, one of which lies adjacent to a TCF binding site, as shown in Figure 1. Primers used for
ChIP assays for the SM22-promoter CArG-containing region (29) were:
GGTCCTGCCCATAAAAGGTTT and TGCCCATGGAAGTCTGCTTGG. Primers for the exon 5 region were AAGCCCAGGAGCATAAGAGGGACT and
GAAGGACAGTGGGCTGGCCATCAG. Primers for the SM -Actin-promoter CArGcontaining region were: AGCAGAACAGAGGAATGCAGTGGAAGAGAC and
CCTCCCACTCGCCTCCCAAACAAGGAGC.