SUPPLEMENTARY INFORMATION
METHODS
Plant Materials
Leaf and floral tissue from Ipomoea quamoclit were collected from a population of this
species near Durham, North Carolina. Leaf and floral tissue from I. purpurea was
obtained from inbred lines originally collected in Durham, North Carolina, and
maintained in a greenhouse through 11 generations of selfing.
Pigment Identification
Total flavonoids were extracted from flowers by soaking corollas in 2N HCl for one
hour, then boiling for one hour. Anthocyanidins were then extracted from the HCl with a
few drops of iso-amyl alcohol. This extract was lyophilized, then resuspended in
methanol with 1% HCl. Anthocyanidins were separated using thin-layer chromatography
on cellulose-coated glass plates in forestal solvent (acetic acid: HCl: water, 30:3:10)1.
Identities of anthocyanidins were determined by comparison with known standards.
Cloning of F3’h and Dfr-B
The sequence of Dfr-B from I. purpurea has previously been reported2. The
sequence of I. purpurea F3’h was supplied by S. Iida3. Primers based on these sequences
(Table S1) were designed and used to amplify full-length cDNA clones of these genes
from I. purpurea and I. quamoclit floral bud tissue using rt-PCR. The PCR protocol used
consisted of 35 cycles of the regime 95C for 30 sec., 50 C for 1 min. 30 sec., 70C for1
min., followed by a 7 min. extension at 72C. PCR products were cloned (TA-cloning
-1-
kit, Invitrogen) and sequenced for verification. Genes were subsequently sub-cloned into
the vector pBI 1.4t containing the constitutive CaMV 35S promoter and Kanamycin and
Gentamycin resistance for complementation analysis. Sequences of the I. quamoclit
genes have been deposited in GenBank (Accession No. AY463156 and AY463157).
Complementation Analyses
To determine whether F3’h and Dfr from both species are functional in vivo, we
employed the complementation analysis described by4. In this analysis, the gene whose
function is to be assessed is transformed into a strain of Arabidopsis thaliana that is
doubly homozygous for a knockout mutant of the native gene. Normally, A. thaliana
produces copious anthocyanins in leaves when plants are stressed by germinating them
on pure sand. The knockout mutants, however, fail to produce anthocyanins because the
anthocyanin biosynthetic pathway is blocked. Transformations of functional genes from
other, often taxonomically distant, species (e.g.. maize) restores anthocyanin production
in the mutant strain4. Failure to restore anthocyanin production thus indicates nonfunctionality of the tested gene.
Mutant A. thaliana strains used were obtained from the Arabidopsis Biological
Resource Center (Ohio State University) and carried a single Transparent testa (tt)
mutant in homozygous form: either tt7-1, a knockout of F3’h, or tt3-1, a knockout of Dfr.
Genes in the vector pBI 1.4t (described above) were transformed into the Agrobacterium
tumefasciens strain GV3101 using a freeze-thaw protocol5. The genes were then
transformed into the appropriate A. thaliana mutant strain using the standard dip
protocol6. Transformants were selected by growing on MS medium containing 50mg/l
Kanamycin. Four to eight T1 plants that carried Kanamycin resistance were transferred to
-2-
soil and allowed to self-fertilize to produce T2 plants. Anthocyanin phenotypes of T2
plants were scored by germinating seeds in sand under high light; the anthocyanins were
then extracted as above from the first true leaves and run out on TLC plates. To confirm
success of transformations, T2 plants were transplanted to soil and allowed to mature.
DNA was extracted and scored for the presence of the transgene by PCR-cloning,
followed by sequencing. In addition, RNA was extracted from seedlings grown in sand
under high light and rt-PCR was performed to confirm expression of the transgene.
Enzyme Assays
To determine whether F3’h and Dfr are functional in vitro, the protein products of
these genes were tested for catalytic activity in enzyme assays. Clones of each gene from
both I. purpurea and I. quamoclit in the pBI 1.4t vector were grown and expressed in E.
coli. Cultures were grown in LB broth with 50 mg/l Kanamycin at 37C and expression
was induced with 200µl of 1M IPTG. When cell density reached OD600 = 1, the cells
were collected by centrifugation and resuspended in 100 l 1M HEPES buffer. Proteins
were extracted from cell culture by disruption in 100-200 l HEPES buffer with 10 l of
100 mg/ml lysozyme for 30 min. on ice. Because F3’H is a membrane-associated
protein, whereas DFR is soluble, assays were run using the total extract for F3’H assays,
but using the supernatant after centrifugation (15000 rpm for 20 min. at 0C) for DFR
assays.
F3’H activity was measured using a protocol modified from7,8. 200 l of
homogenized, lysed cells were combined with 0.1M Tris (pH 7.4) solution, 1 mol
NADPH, 6 mol glucose-6-phosphate, 1 unit of glucose-6-phosphate dehydrogenase,
and 1 mol of the substrate dihydrokaempferol (DHK), dissolved in ethanol, for a final
-3-
reaction volume of 1 ml. The reaction was incubated for 90 minutes at 30C and
immediately extracted twice with 1 ml of ethyl acetate. Products were separated using
thin layer chromatography on cellulose-coated glass plates using a chloroform: acetic
acid: water (10:9:1) solvent and visualized under UV light. Spots that cosegregated with
the reaction product dihydroquercitin (DHQ) were scraped off the plates and dissolved in
100% ethanol. The absorbance of these solutions was measured at a wavelength of 289
nm, which corresponds to the major absorbance peak of DHQ. Reactions with an empty
vector were run as controls. Three reactions of each type were run.
DFR activity was assayed using the method of8. This is an assay of the ability of
DFR to convert dihydroflavonols to leucoanthocyanidins. Leucoanthocyanidins are
subsequently non-enzymatically converted to visible anthocyanidins, the absorbance of
which is measured. 1 ml reactions with 200 l of the DFR protein preparation, or empty
vector, were incubated with in 0.1 M Tris (pH 7.4) containing either 1 µmol of either
DHQ, DHK, or no substrate for 20 minutes at 30C. Amount of product produced was
quantified by measuring absorbance at 535 nm for cyanidin (DHQ as substrate) or 520
nm for pelargonidin (DHK as substrate). Seven reactions of each type were run.
F3’h Expression Assays
To determine the expression levels of F3’h and Dfr, relative to other anthocyanin
structural genes, DNA slot blots were constructed using a Bio-Dot SF Microfiltration
Apparatus (Bio-Rad) following the manufacturer’s instructions. Genes spotted were:
chalcone synthase (Chs-D) from I. purpurea; chalcone isomerase (Chi) from I. purpurea;
flavonone 3-hydroxylase (F3h) from I. purpurea; dihydroflavonol reductase (Dfr-B) from
-4-
I. purpurea and I. quamoclit; anthocyanidin synthase (Ans) from I. purpurea and I.
quamoclit; UDP-glucose flavonoid 3-glucosyltransferase (Uf3gt) from I. purpurea; and
flavonoid 3’-hydroxylase (F3’h) from I. purpurea and I. quamoclit. 100 ng of each gene
was spotted onto a Zeta-Probe membrane (Bio-Rad) and fixed by exposure to UV light.
The spotted genes were obtained by PCR from cDNA of the appropriate species, and
were full-length copies for all genes except Chs-D and Dfr-B from I. purpurea. For ChsD, the second of two exons, representing 989 of the 1167 bp of the coding region was
spotted; for Dfr-B, 990 bp from the 3’ end of the coding sequence, out of a total coding
region of 1163 bp, were spotted.
cDNA Probes were constructed from total RNA extracted from bud tips (the distal
half of the bud) of I. purpurea and I. quamoclit that were 1 day before opening. 5 g of
RNA was reverse-transcribed using M_MLV reverse transcriptase (Invitrogen) and
oligo(dT)15 as a primer in a reaction mixture containing 32P dCTP. Unincorporated
nucleotides were separated from the labled cDNA using ProbeQuant G-50 Micro
Columns (Amersham). Membranes were probed overnight at 65C and washed
according to the manufacturer’s instructions. The probe signal was captured and
visualized using a phosphorimager (Molecular Dynamics).
Phylogenetic Analysis
A phylogeny of 13 Ipomoea species (including those species shown in Fig. 1 plus
I. cairica and I. sepiaria as outgroups) was determined based on sequence of the internal
transcribed spacers of nuclear ribosomal DNA (ITS). ITS sequences were obtained from
Refs.9-11. A maximum likelihood analysis based on the HKY85+G model was performed
in PAUP* version 4.0b1012. Branch support was estimated with 100 bootstrap replicates.
-5-
________________________________________________________________________
1. Harbourne, J.B. Comparative Biochemistry of the Flavonoids, (Academic Press,
London, 1967).
2. P. Tiffin, Miller, R.E. & Rausher, M.D. Control of expression patterns of
anthocyanin structural genes by two loci in the common morning glory. Genes
Genet. Syst., 73, 105-110 (1998).
3. Hoshino, A. et al. Spontaneous mutations of the flavonoid 3’-hydroxylase gene
conferring reddish flowers in the three morning glory species. Plant Cell Physiol.,
44, 990-1001 (2003).
4. Dong, X., Braun, E.L. & Grotewold, E. Functional conservation of plant
secondary metabolic enzymes revealed by complementation of Arabidopsis
flavonoid mutants with maize genes.
Plant Physiol., 127, 46-57 (2001).
5. An, G., Ebert, P.R., Mitra, A. & Ha, S.B. pp. A3: 1-19in Plant Molecular Biology
Manual, ed. S. B. Gelvin and R. A. Schilperoort (Kluwer Academic Publishers,
Dordrecht, 1988).
6.
S.J. Clough, & Bent, A. F. Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana. Plant J., 16, 735-743.
7. Forkmann, G. & Ruhnau, B. Distinct substrate specificity of dihydroflavonols 4reductase from flowers of Petunia hybrida. Z. Naturforsch., 42, 1146 (1987).
8. Stafford, H.A. & Lester, H. H. Enzymatic and nonenzymatic reduction of (+)dihydroquercitin to its 3,4-diol. Plant Physiol., 70, 695-698 (1982).
-6-
9. Miller, R.E., Rausher, M.D. & Manos, P.S. Phylogenetic systematics of Ipomoea
(Convolvulaceae) based on ITS and waxy sequences. Syst. Bot., 24, 209-227
(1999).
10. Manos, P.S., Miller, R.E. & Wilkin, P. Phylogenetic analysis of Ipomoea,
Argyreia, Stictocardia, and Turbina suggests a generalized model of
morphological evolution in morning glories. Systematic Botany, 26, 585-602
(2001).
11. Miller, R. E., McDonald, J. A. & Manos, P. S. Systematics of Ipomoea subgenus
Quamoclit (Convolvulaceae) based on ITS sequence data and a Bayesian
phylogenetic analysis. Am. J. Botany (in press).
12. Swofford, D.L. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other
Methods), Version 4.0, (Sinuar Associates, Sunderland, Massachusetts, 2000).
-7-
Table S1. PCR primers used in obtaining full-length cDNA clones of F3’h
from I. purpurea (P15-N4) and I. quamoclit (P15-P84) and Dfr from I.
purpurea (DFR31-DFRVR2) and I. quamoclit (DFRIF-DFRIR).
Primer name
Primer sequence (5’ 3’)
P15
AAGACCAAGTATGGCTACC
N4
GGTCGAAAGCTAGACCTCTGTTTAAGTG
P84
TTAATTGAGAGTATAGAGATG
DFR31
CTTCGGTAGAAGCTTAGCTTATTGATCCG
DFRVR2
GCTTGAGAAGCTAAGCACACTG
DFRIF
GATCCGAGGACATATGGTGGACGGTAATCATCC
DFRIR
CTGATACACCTATGGTGCCATGGTGTTGTAG
-8-