Tick-Borne Encephalitis virus natural foci emerge in Western
Sweden
by
Catherine Brinkley1*, Peter Nolskog2, Irina Golovjova3, Åke Lundkvist3, Tomas Bergström1
1
Department of Virology, Göteborg University, Göteborg, Sweden
Department of Infectious Diseases, Skovde Hospital, Skovde, Sweden
3
Swedish Institute for Infectious Disease Control, Stockholm, Sweden
2
Keywords: flavivirus, tick-borne encephalitis virus, RT-PCR, ticks, molecular
epidemiology
*Corresponding author
Catherine Brinkley
Department of Virology
University of Göteborg
Guldhedsgatan 10B
S-413 46 Göteborg, Sweden.
Phone: (46) 704589295
Fax: (46) 31 3424860
Email: catherinebrinkley05@fulbrightweb.org
1
Abstract
There has been an emergence of tick-borne encephalitis (TBE) cases in Western Sweden over
the past 10 years. Human cases cluster in distinct regions around major bodies of water,
raising the question of TBE prevalence in ticks within these defined hotspots. This study was
based on a collection of 7,120 nymph, 222 adult female, 222 adult male, and 132 fed female
ticks from cows in 4 suspected TBE foci, based on human cases, and 2 non-endemic areas of
Western Gotaland. All tick pools were screened with Real Time RT-PCR targeting the noncoding 3’ region. Prevalence in ticks in the endemic areas ranged from 0.1-0.42 %, which is
comparable with other more established TBE endemic regions in Europe. Of the 18 positive
pools, viral copy numbers ranged from 500 to 3.7·109 copies/pool. Sequence data from a TBE
patient in Western Gotaland confirmed that the Western European-subtype of TBEV has
spread to Western Sweden.
2
Introduction
The tick-borne encephalitis virus (TBEV) belongs to the family of Flaviviridae. The TBE
complex shares 77-98% amino acid similarity in the E protein, making the E protein region a
prime target for sequencing in phylogeny studies (Gao et al., 1993; Mandl et al., 1993). There
are three sub-types of TBE: Far Eastern (FE), Siberian (Sib) and Western-European (WE)
(Wallner et al., 1996; Gritsun et al., 2003b; Pogodina et al., 2004). In Europe and Russia,
TBEV is a high impact CNS pathogen with approximately 12,000 diagnoses annually
(Gunther and Haglund, 2005). The virus causes a variety of clinical manifestations, with
neurological manifestations in up to 30% of the patients (Gustafson et al., 1993). Lethality of
WE-TBEV found in Europe is <2%, but post encephalitic syndrome is seen in over 40% of
infected patients, often severely impairing their quality of life (Gunther et al., 1997).
Antiviral treatment is currently lacking, though there are two vaccines currently available that
effectively prevent TBEV infection (Heinz et al., 1980; Klockmann et al., 1991).
In Scandinavia, the first reports of TBE from Sweden, Finland, Denmark and Norway date
back to 1954, 1956, 1963, and 1997 respectively (Skarpaas et al., 2006). In Sweden, routine
TBEV surveillance since 1956 and neutralizing antibody assays of TBEV on cattle sera in the
1950s placed most TBE natural foci around Stockholm though recent years have seen TBE
spread north and west (von Zeipel et al., 1959; Lindgren and Gustafson, 2001; Haglund,
2002). Annually, Sweden reports >100 cases each year, and that number is rising. In the
Western Gotaland region, situated at the south-west part of Sweden, TBE was previously a
non-existent or unnoticed human disease. During the last decade, however, a growing
number of cases have been diagnosed, making TBEV one of the most threatening emerging
diseases in the investigated region.
3
TBEV in Sweden is transmitted largely by Ixodes ricinus hard ticks, which can live from 2-5
years. TBEV spreads to ticks when they feed either viremic or nonviremic animals (Labuda
et al., 1993a; Labuda et al., 1997; Randolph et al., 1999; Gritsun et al., 2003a). Vertical
transstadial and sexual transmission can occur among both ticks and warm-blooded hosts
(Molnarova and Mayer, 1980; Khozinsky et al., 1985). Once infected, the tick remains
infected through-out its life-cycle (Kozuch and Nosek, 1980; Nosek et al., 1986; Rosa et al.,
2003).
The low-endemic region of Western Gotaland is well suited for studies on the epidemiology
of TBEV. In addition to routine surveillance of TBE cases and seroprevalence studies,
determining TBEV prevalence in free living tick populations and quantities of TBEV RNA in
ticks helps to verify TBE foci, assess the transmission risk from a tick bite, and predict the
epidemiology of the disease for immuno-prophylactic strategies. For this purpose, samples of
ticks were collected from different parts of Western Gotaland, the front of the epidemic.
Additionally, TBEV from Western Gotaland was phylogentically analyzed to trace the origin
of the TBEV spread in this region.
Materials and Methods
Collection of Ticks
All TBE locations were selected according to interviews with TBE patients about suspected
areas where they had contracted TBE (Table 2). Four different locations were chosen from
areas where more than five patients had contracted TBE in the past ten years (Fig. 1). In total,
four TBE locations were sampled and two control areas (Fig. 1). Areas where pools of
questing ticks were collected are detonated with “T”, while ticks taken from cows were
labeled “C” (Fig.1). Annual precipitation was in the range of 600-1000 mm/year for all sites.
4
Host composition for each of the areas included small mammals, foxes, badgers, elk and an
abundance of roe deer. Cattle were present in tick spots in T2, C1-3.
With the exception of ticks collected from T4 in 2004, all other ticks were collected between
May-September 2006. Ticks were collected by dragging a 1 m2 white flannel cloth through
forest and meadow vegetation. Ticks were pooled accordingly: 20 nymphs, 10 females, or 10
males.
Feeding ticks were collected from cows in two non-endemic areas (C2, C3, Fig. 1), and the
TBE location C1 (Fig. 1), 1 km away from the collection site for questing ticks (T1, Fig. 1).
Feeding ticks were thought to be a more sensitive TBEV assay (Suss et al., 2006; Suss et al.,
2004). Each partially or fully fed tick was processed individually, while male ticks found
with the feeding females were pooled as mentioned above. After collection, ticks were stored
at -70 °C.
Extraction of TBEV RNA
Frozen tick pools were transferred to tubes of MagNA Lyser Green Beads (Roche,
Mannheim, Germany) then 1ml of sterile PBS was added to each tube. Immediately after
adding buffer, tubes were transferred to the MagNA Lyser instrument (Roche Diagnostics
Scandinavia AB, Stockholm). Samples were homogenized for 50 s at 6,000 rpm, and then
cooled for 1 min in the MagNA Lyser Rotor Cooling Block (Roche Diagnostics Scandinavia
AB, Stockholm). Homogenization and cooling were repeated once. 100 μl of homogenized
tick solution was added to 250 μl of lysate buffer and incubated at room temperature for 30
minutes before RNA extraction with the MagNA Pure LC Isolation station (Roche
Diagnostics Scandinavia AB, Stockholm). Total RNA was isolated from ticks using the
5
MagNA Pure LC RNA Isolation Kit III for Tissue (Roche Diagnostics Scandinavia AB,
Stockholm) and eluted at a volume of 100 μl according to the supplier’s protocol. This
procedure includes a DNAse step to remove excess DNA.
TaqMan one-step quantitative RT-PCR assay
As controls, the following European subtypes of TBEV were used: Hoschosterwitz, isolated
from a tick in Carinthia, Austria, in 1971 (Heinz and Kunz, 1981), and the Far Eastern
subtype TBE virus strain Sofyn (Pletnev, 1990).
Quantification of TBEV wild-type RNA was done using a plasmid serial dilution from 8000
to 106 copies per reaction as a standard. A synthetic fragment corresponding to the amplified
region of the TBEV wild-type was cloned into the pUC57 cloning vector containing a lacZ
promoter for in vitro transcription (GenScript Corp, New Jersey, USA). Lyophilized plasmid
was diluted to desired concentrations using carrier Poly-deoxy-inosinic-deoxy-cytidylic acid
(Roche, Sweden) with a Ct value of 27 corresponding to 1,000,000 Genetic equivalents/ml
according to the supplier’s protocol. One genetic equivalent is regarded as one viral RNA
copy.
For RT-PCR of TBEV a method described by Schwaiger and Cassinotti (2003) was used,
with minor modifications to enhance Tm values (melting temperatures) of the
oligonucleotides: forward primer TGGGCGGTTCTTGTTCTCC, reverse primer
TCACACATCACCTCCTTGTCAGA, and Taqman probe FAMCTGAGCCACCATCACCCAGACACAG-TAMRA (FAM, 6-carboxyfluorescein; TAMRA,
6-carboxytetrametylrhodamine). This method targets a part of the 3’ non-coding region of the
TBEV genome that is conserved in essentially all TBEV subtypes, and the amplicon is located
to nt 11054-11123 of the Neudoerfl (European) subtype of TBEV (accession number
6
U27495). A PCR for a tick house-keeping gene,16S Ixodes tick RNA, was run in parallel as
an overall control for RNA extraction and amplification as previously described by Schwaiger
and Cassinotti (2003). All primers and probes were synthesized by MWG-Biotech AG
(Ebersberg, Germany).
RT-PCR was done with TaqMan one-step RT-PCR Mastermix Reagents Kit from Applied
Biosystems (Branchburg, NJ, USA). RT-PCR mixtures consisted of 50 μl reaction volumes
each containing 25 μl AmpliTaq Gold DNA Polymerase Mix (2x), 1.25 μl RT enzyme mix,
350 nM of the forward primer and reverse primer, and 250 nM of the TaqMan probe. 20 μl of
RNA tick extract were used for TBEV RT-PCR and 2 μl were used for tick 16S RT-PCR with
corresponding primers and probes. The remaining volume of each reaction was filled with
RNase-free sterile water (Invitrogen, Stockholm).
All one-step PCR reactions were carried out in a 96-well plate, which was centrifuged for
1 min at 1000×g at room temperature in a swing-out rotor (Rotina 48R; Hettich, Tuttlingen,
Germany) to remove small air bubbles in the reaction vessels. Amplification and detection
were carried out as a one-step RT-PCR including a 30 min RT step at 48°C, followed by
incubation at 95 °C for 10 min prior to two-step amplification (95°C 15 s, 60°C 60 s, 45
cycles) on an ABI 7300 Sequence Detection System (Applied Biosystems).
Statistical Analysis
At the 95% confidence interval, sample size and realized prevalence of each location was
used to find the recommended number of pools collected in order to statistically prove
prevalence in a perfect test (Segeant, 2007). The adjusted prevalence and confidence intervals
were calculated based on pool size and a perfect test using the pooled prevalence calculator
(Segeant, 2007).
7
Phylogenetic Analysis
The partial E-gene sequence of TBE patient sera from location T2 was named “Vinninga”.
The sequence data were aligned using ClustalW (version 1.83) with the following sequences:
TBEV strain Oshima C1 (accession number: AB022294), TBEV strain Oshima 5-10
(AB022292), Japan (AB022292), TBEV strain KH98-10 (AB022297), TBEV strain Sofjin
(X03870), TBEV strain Vasilchenko (AF069066), TBEV strain Lat 1-96 (AJ415565), Greek
goat encephalitis virus (X77732), TBEV strain Turkey (L01265), Omsk haemorrhagic fever
virus (X66694), Powassan virus (L06436), Kyasanur forest disease virus (X74111), Langat
virus (AF253419), Spanish sheep encephalitis virus (X77470), Louping Ill virus (Y07863),
TBEV strain Est-2546 (DQ393779), Negishi virus (M94956), TBEV strain Kumlinge-A52
(X60286), TBEV strain Neudoerfl (U27495), TBEV strain Hypr (U39292), Kokkola-118
from Finland (DQ451296), Kokkola-102 from Finland (DQ451295), Norway (Skarpaas et al.,
2006), Denmark (Skarpaas et al., 2006), Swedish TBEV strain Toro-2003 (DQ401139),
TBE-263 (U27491), and Yellow Fever (NC_002031). Phylogenetic analyses excluded
sequence regions containing gaps. The PHYLIP program package (v. 3.66, Felstein, J., 1993.
PHYLIP (Phylogeny Inference Package), distributed by the author, Department of Genetics,
University of Washington, Seattle) was used to generate 100 bootstrap replicates of the
sequence data (seqboot, consense). Maximum likelihood (dnaml) and Parsimony (dnapars)
methods were compared. Trees were rooted using the Yellow Fever Virus strain.
Results
PCR Methodology
The methodology used to detect TBEV RNA in the tick population was found to be reliable,
sensitive and yielded optimal results when compared to other methods. Such sensitivity is
key as the amount of virus present may be extremely low at the time of testing due to freezing
and thawing of the samples, replication cycle of the virus, or the decrease in viral copy
8
numbers depending on the developmental stage in ticks (Kozuch and Nosek, 1985;
Puchhammer-Stockl et al., 1995).
Previous studies (Schwaiger and Cassinotti, 2003) have shown that there is no inhibition of
RNA in tick samples. This was verified by dilution studies in TBEV positive samples.
Likewise, the tick-specific extraction control, 16S rRNA, was successfully amplified in all
samples and showed no signs of inhibitory factors based on dilution tests. However, when
run with out the RT step, 16S rRNA was amplified on average 5 cycles after samples with the
RT step, indicating that DNA constitutes approximately 3% of the quantity of 16S rRNA
samples. 16S rRNA is therefore a total nucleic acid quality control step as opposed to being
solely an RNA quality control. For unfed, questing ticks, 16S rRNA had Ct value range of
16-25 with a mean of 22. For ticks feeding from cows, tick 16S rRNA had a Ct value range
of 19-27 with a mean of 24. The higher 16S rRNA Ct value for ticks feeding on cows (which
corresponds to less 16S rRNA in these samples) can be explained in that less of the sample
make-up was derived from processed tick, and instead most of the sample consisted of the
feeding tick’s meal of compressed erythrocytes from cow blood, thereby giving a lower tickspecific16S rRNA reading.
The MagNA Lyser method proved superior to traditional hand-grinding methods. When
compared to traditional hand grinding methods, the MagNA Lyser yielded tick 16S rRNA
which could be detected 2-3 Ct values lower, which corresponds to 5-10 times more copies of
tick RNA. This finding was in spite of the fact that the MagNA Lyser rarely fully
homogenized the tick exoskeleton, though all the internal organs were homogenized.
Presumably, the enclosed MagNA Lyser system had less potential for contamination and
retained more sample throughout the processing.
9
The success of detecting tick 16s rRNA by RT-PCR at relatively low Ct values verified that
the RNA extraction procedure worked well. Additionally, dilutions of control strains
Horowitz and Sofjin could be detected as low as 10 copies/well with reproducibility; thus
showing the sensitivity of the assay. It was therefore concluded that the RNA extraction and
Taqman PCR procedures gave an optimal viral copy count.
Prevalence
All positive results were reconfirmed from an independent aliquot of the same sample. As
routinely noticed, frozen and thawed samples typically had Ct values 2-3 lower than the
original value, equivalent to a 5-10% decrease in total viral copy count. Such a decrease
could indicate that initial freezing methods decreased viral copy numbers by 5-10% as well,
suggesting that initial viral concentration is somewhat higher in the tick than has been
measured.
Viral copy number in the positive samples had a range spanning 500 – 3.7∙109 copies/pool.
The majority of samples were weakly positive. Of the five positive nymph pools from T1,
four were weakly positive (500-650 copies/pool) while one pool contained 26,000
copies/pool. Feeding ticks taken from cows in the same region (C1) were negative for TBEV.
The four positive pools from T2 were strongly positive with an average of 109 copies/pool
(range: 9.5 ·104 to 3.7·109 copies/pool). The two male pools from T2 had 3.8·108 and 3.7·109
copies/pool. Both T3 nymph pools were weakly positive. Of the seven positive pools from
T4, most were weakly positive with the exception of two pools, one adult pool with 7.2·106
and one nymph pool containing 5·107 copies. All pools except T3 and C1 reflect the true
10
prevalence according to statistical analysis. All collected ticks from both control sites (C2,
C3), although statistically insignificant, were negative for TBEV.
Phylogeny
In order to gain insight on the relationship of the TBEV found in Western Sweden with the
other Scandinavian strains of TBEV, a phylogenetic tree was produced. The phylogenetic
analysis included 17 WE-TBEV subtypes, with one strain each from Sweden, Norway and
Denmark. The-451 nt length region covers part of the E gene, which allows the virus to bind
to the host cell and is therefore involved in the development of epitopes that may cause
neurovirulence (Mandl, 2005). It is also believed that this region is under evolutionary
pressure when the virus circulates to new regions, hosts, or biotopes as it would determine the
virus ability to bind to new host cells.
Maximum Likelihood and Parsimony methods both placed Vinninga, the Western Gotaland
region strain of TBEV, in the WE-TBEV sub-type. The three distinct subtypes of TBE as
well as the Louping Ill viruses cluster accordingly. All Scandinavian strains fell into the WETBEV cluster, relating them closely to Neudoerfl. Furthermore, the Vinninga strain is most
closely related to the Lativa-811 strain with a bootstrap support of 81.
Discussion
This is the first time to our knowledge that TBEV copy numbers have been recorded in ticks
by RT-PCR. The extreme range of viral copy numbers, from 500 to over 109, may give clues
to why some TBE cases are more severe than others. One can assume that a tick with high
TBEV copy numbers would have a higher likelihood of infecting a human and could possibly
transmit disease with higher neurovirulence. There could be several factors that affect how
ticks could acquire such high viral copy numbers: recent feeding on a viremic host,
developmental stage of the tick, or TBEV possibly replicating in the tick.
11
As expected, TBEV prevalence was low for these newly developed hotspots, 0.10-0.42%
(Table 3). Unexpectedly, the TBEV prevalence data in ticks was comparable to PCR-detected
TBEV prevalence in Ixodes ricinus from countries with more established TBEV endemic
regions, 0.04-0.48%, with the exception of Latvia (Table 1, Table 3). The similarities in
prevalence to more well-established European hotspots indicate the rapidity and magnitude
with which TBEV foci may become established. These data also suggest that there may exist
threshold levels for TBEV circulation in tick populations in that only a small percentage of
ticks may get infected with the virus and retain it or survive. This hypothesis is supported by
surveillance of field-collected ticks in Germany from 1997 to 2002, which show steady TBEV
prevalence figures (Suss et al., 2004).
Prevalence in the questing tick population correlated with the clustering of human TBE cases,
but did not correlate to the numbers of TBE cases in each of the regions. There cannot be a
direct correlation between prevalence and incidence as prevention by vaccination, extent of
exposure to ticks, uneven distribution of TBEV, and more severe TBE in elderly people
(Kunze et al., 2006) can distort the amount of TBE cases. Control samples, though all
negative, included too few ticks to conclusively say that TBEV does not exist in these areas.
However, the old mainstay that evidence of new TBE foci are not newly emerged, but instead
are the result of increased awareness can be largely discounted in Western Sweden as there is
a long history of TBE surveillance and NT antibody experiments from the 1950s. Natural
foci confirmed recently by human cases in Southern Sweden in Skane (Fält et al., 2006) and
those well-known TBE-endemic areas around Stockholm had been predicted as early as the
1950s by neutralizing antibodies to TBEV in cow sera (von Zeipel et al., 1959). However,
12
although the sample areas in Western Sweden were surveyed in the 1950s, no NT antibodies
to TBEV were found at the time in the selected regions with the exception of one positive
serum sample from T3. The emergence of TBEV in these areas most likely marks the spread
of the virus to new endemic regions, thus prompting a call for stricter surveillance and
vaccination programs in Western Sweden.
Phylogenetic analysis places Vinninga (the Western Gotaland strain) closest to Latvia-811,
Toro-2003 (the Swedish strain), and the Norwegian strain, with total homogeneity of 97% in
the nucleic acid sequence of these four strains. These strains were also closely related to the
Austrian isolated Neudoerfl strain, which is also found in the Czech Republic, Germany,
Latvia and Lithuania (Lundkvist et al., 2001; Mickiene et al., 2001; Suss et al., 2004;
Weidmann et al., 2006). This supports the theory that TBEV spread from Central Europe to
Sweden and subsequently to Norway as opposed to spread of the virus from Finland or
Russia.
The origins of TBE in Western Gotaland could also be correlated to their locations. Hotspots
in Western Gotaland exist around bodies of water, indicating that perhaps TBEV spread from
ticks attached to migratory water birds, though there is also the possibility of livestock with
ticks transported to these areas for farming. One further explanation is that TBEV spread
across Sweden but only certain patches could support the lifecycles of ticks, hosts, and virus;
and as a result, these patches are where we see TBE cases today. Further analysis of longer
sections of the Swedish TBE strains are needed to give more insight into how TBEV is
spreading across low-endemic regions and establishing new hotspots. In conclusion, these
newly described natural foci have been verified in the tick population and show a distinct
migration of the virus to the Western parts of Sweden.
13
Acknowledgements
We thank Sirkka Vene for technical advice; the detection and quantification department of
Sahlgrenska Hospital for technical assistance; Jan Carlsson, Reiman Franksson, and
Strömmaskolan for assistance with cows; and Oskar Roshed and Inger Karlsson for help tick
collecting. Financial support was received from the VästraGötaland Research Fund.
References
Danielova, V., Rudenko, N., Daniel, M., Holubova, J., Materna, J., Golovchenko, M.,
Schwarzova, L., 2006. Extension of Ixodes ricinus ticks and agents of tick-borne
diseases to mountain areas in the Czech Republic. Int J Med Microbiol. 296 Suppl 40,
48-53.
Fält, J., Lundgren, Å., Alsterlund, R., Carlsson, B., Eliasson, I., Haglund, M., Lundkvist, Å.,
Vene, S., Settergren, B., 2006. Tick-borne encephalitis (TBE) in Skane, southern
Sweden: A new TBE endemic region? Scand. J. Infect. Dis. 38, 800-804.
Gao, G.F., Hussain, M.H., Reid, H.W., Gould, E.A., 1993. Classification of a new member of
the TBE flavivirus subgroup by its immunological, pathogenetic and molecular
characteristics: identification of subgroup-specific pentapeptides. Vir. Res. 30, 129144.
Gritsun, T.S., Lashkevich, V.A., Gould, E.A., 2003a. Tick-borne encephalitis. Antivir. Res.
57, 129-146.
Gritsun, T.S., Nuttall, P.A., Gould, E.A., 2003b. Tick-borne flaviviruses. Adv. Vir. Res. 61,
317-371.
Gunther, G., Haglund, M., 2005. Tick-borne encephalopathies : epidemiology, diagnosis,
treatment and prevention. CNS Drugs. 19, 1009-1032.
Gunther, G., Haglund, M., Lindquist, L., Skoldenberg, B., Forsgren, M., 1997. Intrathecal
IgM, IgA and IgG antibody response in tick-borne encephalitis. Long-term follow-up
related to clinical course and outcome. Clin. Diag. Vir. 8, 17-29.
Gustafson, R., Forsgren, M., Gardulf, A., Granstrom, M., Svenungsson, B., 1993. Clinical
manifestations and antibody prevalence of Lyme borreliosis and tick-borne
encephalitis in Sweden: a study in five endemic areas close to Stockholm. Scand. J.
Infec. Dis. 25, 595-603.
Haglund, M., 2002. Occurrence of TBE in areas previously considered being non-endemic:
Scandinavian data generate an international study by the International Scientific
Working Group for TBE (ISW-TBE). Int. J. Med. Microbiol. 291, 50-54.
Han, X., Aho, M., Vene, S., Brummer-Korvenkontio, M., Juceviciene, A., Leinikki, P.,
Vaheri, A., Vapalahti, O., 2002. Studies on TBE epidemiology in Finland (and
Lithuania). Int. J. Med. Microbiol. 291, 48-49.
Han, X., Juceviciene, A., Uzcategui, N.Y., Brummer-Korvenkontio, H., Zygutiene, M.,
Jaaskelainen, A., Leinikki, P., Vapalahti, O., 2005. Molecular epidemiology of tickborne encephalitis virus in Ixodes ricinus ticks in Lithuania. Journal of medical
virology. 77, 249-256.
Heinz, F.X., Kunz, C., 1981. Homogeneity of the structural glycoprotein from European
isolates of tick-borne encephalitis virus: comparison with other flaviviruses. J Gen.
Virol. 57, 263-274.
14
Heinz, F.X., Kunz, C., Fauma, H., 1980. Preparation of a highly purified vaccine against tickborne encephalitis by continuous flow zonal ultracentrifugation. J. Med. Virol. 6, 213221.
Hudson, P.J., Rizzoli, A., Rosa, R., Chemini, C., Jones, L.D., Gould, E.A., 2001. Tick-borne
encephalitis virus in northern Italy: molecular analysis, relationships with density and
seasonal dynamics of Ixodes ricinus. Med. Vet. Entom. 15, 304-313.
Juceviciene, A., Zygutiene, M., Leinikki, P., Brummer-Korvenkontio, H., Salminen, M., Han,
X., Vapalahti, O., 2005. Tick-borne encephalitis virus infections in Lithuanian
domestic animals and ticks. Scand. J. Infec. Dis. 37, 742-746.
Khozinsky, V.V., Semenov, B.F., Gresikova, M., Chunikhin, S.P., Sekeyova, M., Kozuch, O.,
1985. Role of macrophages in the pathogenesis of experimental tick-borne
encephalitis in mice. Acta Virol.. 29, 194-202.
Klockmann, U., Bock, H.L., Kwasny, H., Praus, M., Cihlova, V., Tomkova, E., Krivanec, K.,
1991. Humoral immunity against tick-borne encephalitis virus following manifest
disease and active immunization. Vaccine. 9, 42-46.
Kozuch, O., Nosek, J., 1980. Experimental transmission of tick-borne encephalitis (TBE)
virus by Haemaphysalis concinna ticks. Acta Virol.. 24, 377.
Kozuch, O., Nosek, J., 1985. Replication of tick-borne encephalitis (TBE) virus in Ixodes
ricinus ticks. Folia parasitologica. 32, 373-375.
Kunze, U., Baumhackl, U., Bretschneider, R., Chmelik, V., Grubeck-Loebenstein, B.,
Haglund, M., Heinz, F., Kaiser, R., Kimmig, P., Kunz, C., Kunze, M., Mickiene, A.,
Misic-Majerus, L., Randolph, S., Rieke, B., Stefanoff, P., Suss, J., Wimmer, R., 2006.
The Golden Agers and Tick-borne encephalitis. Conference report and position paper
of the International Scientific Working Group on Tick-borne encephalitis. Vaccine.
24, 1236-1237.
Labuda, M., Danielova, V., Jones, L.D., Nuttall, P.A., 1993a. Amplification of tick-borne
encephalitis virus infection during co-feeding of ticks. Med. Vet. Entemol. 7, 339-342.
Labuda, M., Kozuch, O., Zuffova, E., Eleckova, E., Hails, R.S., Nuttall, P.A., 1997. Tickborne encephalitis virus transmission between ticks cofeeding on specific immune
natural rodent hosts. Virology. 235, 138-143.
Labuda, M., Stunzner, D., Kozuch, O., Sixl, W., Kocianova, E., Schaffler, R., Vyrostekova,
V., 1993b. Tick-borne encephalitis virus activity in Styria, Austria. Acta Virol.. 37,
187-190.
Lindgren, E., Gustafson, R., 2001. Tick-borne encephalitis in Sweden and climate change.
Lancet. 358, 16-18.
Lundkvist, Å., Vene, S., Golovljova, I., Mavtchoutko, V., Forsgren, M., Kalnina, V.,
Plyusnin, A., 2001. Characterization of tick-borne encephalitis virus from Latvia:
evidence for co-circulation of three distinct subtypes. J. Med. Virol. 65, 730-735.
Mandl, C.W., 2005. Steps of the tick-borne encephalitis virus replication cycle that affect
neuropathogenesis. Virus Res. 111, 161-174.
Mandl, C.W., Holzmann, H., Kunz, C., Heinz, F.X., 1993. Complete genomic sequence of
Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne
flaviviruses. Virology. 194, 173-184.
Mickiene, A., Vene, S., Golovljova, I., Laiskonis, A., Lindquist, L., Plyusnin, A., Lundkvist,
A., 2001. Tick-borne encephalitis virus in Lithuania. Eur. J. Clin. Microbiol. Infect.
Dis. 20, 886-888.
Molnarova, A., Mayer, V., 1980. Experimental infection of pregnant mice with viruses of the
tick-borne encephalitis (TBE) complex. Acta Virol.. 24, 297.
15
Nosek, J., Chunikhin, S.P., Gresikova, M., Korolev, M.B., Kozuch, O., Stefutkina, L.F.,
Ivannikova, T.I., 1986. Peculiarities of tick-borne encephalitis virus reproduction in
Haemaphysalis inermis ticks and their explants. Acta Virol. 30, 396-401.
Pletnev, A.G., V. F. Yamshchikov, and V. M. Blinov. , 1990. Nucleotide sequence of the
genome and complete amino acid sequence of the polyprotein of tick-borne
encephalitis virus. Virology. 174, 250-263.
Pogodina, V.V., Bochkova, N.G., Karan, L.S., Trukhina, A.G., Levina, L.S., Malenko, G.V.,
Druzhinina, T.A., Lukashenko, Z.S., Dul'keit, O.F., Platonov, A.E., 2004. The
Siberian and Far-Eastern subtypes of tick-borne encephalitis virus registered in
Russia's Asian regions: genetic and antigen characteristics of the strains. (In Russian).
Vopr. Virusol. 49, 20-25.
Puchhammer-Stockl, E., Kunz, C., Mandl, C.W., Heinz, F.X., 1995. Identification of tickborne encephalitis virus ribonucleic acid in tick suspensions and in clinical specimens
by a reverse transcription-nested polymerase chain reaction assay. Clin. Diag. Virol. 4,
321-326.
Randolph, S.E., Miklisova, D., Lysy, J., Rogers, D.J., Labuda, M., 1999. Incidence from
coincidence: patterns of tick infestations on rodents facilitate transmission of tickborne encephalitis virus. Parasitol. 118, 177-186.
Rosa, R., Pugliese, A., Norman, R., Hudson, P.J., 2003. Thresholds for disease persistence in
models for tick-borne infections including non-viraemic transmission, extended
feeding and tick aggregation. J Theor. Biol. 224, 359-376.
Schwaiger, M., Cassinotti, P., 2003. Development of a quantitative real-time RT-PCR assay
with internal control for the laboratory detection of tick borne encephalitis virus
(TBEV) RNA. J. Clin. Virol. 27, 136-145.
Segeant, E. 2007. http://www.ausvet.com.au/pprev/.
Skarpaas, T., Golovljova, I., Vene, S., Ljostad, U., Sjursen, H., Plyusnin, A., Lundkvist, A.,
2006. Tickborne encephalitis virus, Norway and Denmark. Emerg. Infec. Dis. 12,
1136-1138.
Suss, J., Klaus, C., Diller, R., Schrader, C., Wohanka, N., Abel, U., 2006. TBE incidence
versus virus prevalence and increased prevalence of the TBE virus in Ixodes ricinus
removed from humans. Int. J. Med. Microbiol. 296, 63-68.
Suss, J., Schrader, C., Abel, U., Bormane, A., Duks, A., Kalnina, V., 2002. Characterization
of tick-borne encephalitis (TBE) foci in Germany and Latvia (1997-2000). Int. J. Med.
Microbiol. 291, 34-42.
Suss, J., Schrader, C., Falk, U., Wohanka, N., 2004. Tick-borne encephalitis (TBE) in
Germany--epidemiological data, development of risk areas and virus prevalence in
field-collected ticks and in ticks removed from humans. Int. J. Med. Microbiol. 293,
69-79.
Wallner, G., Mandl, C.W., Ecker, M., Holzmann, H., Stiasny, K., Kunz, C., Heinz, F.X.,
1996. Characterization and complete genome sequences of high- and low- virulence
variants of tick-borne encephalitis virus. J Gen. Virol. 77, 1035-1042.
Weidmann, M., Schmidt, P., Hufert, F.T., Krivanec, K., Meyer, H., 2006. Tick-borne
encephalitis virus in Clethrionomys glareolus in the Czech Republic. Vector Borne
Zoonotic Dis. 6, 379-381.
von Zeipel, G., Svedmyr, A., Zetterberg, B., 1959. The Geological Distribution in Sweden of
Viruses Belonging to the Russian Spring-Summer-Louping Ill Group; Serological
Survey of Antibodies in Cow Sera. Archiv Fur die gesamte Virusforschung. Band IX,
449-459.
16
Legends to Illustrations
Table 1. TBEV prevalence in Ixodes ricinus ticks as confirmed by PCR methods. N=nymphs, A=adults where
applicable. All methods used a nested-PCR technique and prevalence percentages range from zero to the below
listed value depending on region within the country.
Country
Italy
Lithuania
Prevalence
(%)
0.04
0.19
Norway
Finland
Czech Republic
Austria
Germany
Latvia
0.25
0.34
0.4
0.44
0.41 N, 0.6 A
2.4 N, 3.0 A
Ticks tested
Reference
13,885 (Hudson et al., 2001)
3234 (Han et al., 2005)
(Juceviciene et al., 2005)
810 (Skarpaas et al., 2006)
589 (Han et al., 2002)
491 N (Danielova et al., 2006)
3,404 (Labuda et al., 1993b)
18,360 N 3,350 A (Suss et al., 2004, 2006)
175 N, 350 A (Suss et al., 2002)
Table. 2. Geographical coordinates and environmental description for each of the sample
areas.
T1
T2
T3
T4
C1
C2
C3
GPS coordinates
Lat: N 57º 52' 44"
Long: E 11º 46' 23"
Lat: N 58º 34' 42"
Long: E 12º 59' 4"
Lat: N 58º 47'
Long: E 13º 45'
Lat: N 58º 40' 42"
Long: E 13º 39' 50"
Lat: N 57º 53' 35"
Long: E 11º 50' 29"
Lat: N 58º 15'
Long: E 11º 35'
Lat: N 57º 33' 36",
Long: E 12º 26' 53"
environmental description
forest undergrowth located adjacent to a
shalow pond and golf course
forest undergrowth in a near footpaths
forest undergrowth along logging paths
forest undergrowth near large lake
clear cut cow pasture boardering forest
forest undergrowth and pastures
forest undergrowth and pastures
Table 3. TBEV in Low Endemic Areas. *Signifies positive pool. For C1-3, female numbers
signify individual ticks. All other counts are the numbers of pools consisting of 10 adults and
20 nymphs. Adults in region T4 were not sexed, but were separated by developmental stage.
T1
T2
T3
T4
C1
C2
C3
Nymph
Female Male
Total Positive Adjusted
Confidence
pools
pools
pools
Ticks Pools
Prevalence (%) Interval (%)
61*****
1
1
1240
5
0.42
0.15-0.90
66**
11
12**
1550
4
0.26
0.08-0.61
92**
10
9
2030
2
0.10
0.02-0.31
137******
7*
2810
7
0.27
0.11-0.51
0
42
1
43
0
0
0
0
27
1
28
0
0
0
0
63
0
63
0
0
0
17
Figure 1. Human TBE cases from 1997-2006. Sampling spots (T1-4 for unfed questing ticks, C1-3 for ticks
feeding from cows) are denoted with circles over each area.
18
Figure 2. Maximum likelihood tree based on E gene encoding nucleotide sequences (nt 1354-1805 in strain
Neudoerfl). The tree is rooted by the Yellow Fever Virus. All horizontal branch lengths are drawn to scale.
Bootstrap values greater than 70% are shown.
19