CVR-2011-1122R1
Materials and Methods
Constructs – All the constructs described in this section were cloned into recombinant adenoviruses,
propagated, and titered, as previously described by Dr. Frank Graham (25).
1) The stem-loop
precursor of mmu-miR-26b and mmu-miR-208b were synthesized by Integrated DNA Technology (IDT)
with the appropriate restriction sites overhangs for cloning. 2) The miR-26b eraser is designed as a
tandem repeat of the antisense sequence of mature miR-26 with a terminal (T)6 (IDT) and cloned
downstream of a U6 promoter. 3) Full-length human GATA4 (NM_002052.2) was purchased from
Origene. 4) GATA4 gene mutants lacking the 3’UTR (GATA4∆3’UTR), the miR-26a/b (GATA4∆26),
and the miR-208 (GATA4∆208) target sites were constructed by a combination of PCR and a 2-step
cloning strategy to exclude the regions indicated.
5) Hairpin forming, silencing, oligonucleotides
encompassing nt 1242-1261 (AAGGCAGAGAGTGTGTCAAT) of mouse GATA4 (NM_008092.3) or nt
1795-1814 (GGA AGT GGT AAG AAG AAG CT) of mouse PLCb1 (NM_019677.2), were synthesized
with the appropriate restriction sites overhangs for cloning (IDT).
6) A concatamer of miR-26b-
predicted target sequence within the GATA4 3’UTR (GAACAACUGGGUAGAACUUGAAG)x3 with the
appropriate restriction sites overhangs for cloning (IDT), was cloned in the 3’UTR of the luciferase gene
(miR-26 reporter). 7) Nucleotides 4020-6998 of the 3’UTR of mouse PLCb1 (NM_001145830.1) was
cloned by reverse transcription and PCR from mouse heart RNA. From this, a mutant lacking nt 63296490 encompassing the miR26b target sequence was constructed. Each was cloned downstream of a
luciferase gene (PLC1-3’UTR and PLC1-3’UTRmiR26, respectively). 8) The GATA4 luciferase
reporter
vector,
which
has
4xGATA4-dependent
cis-acting
enhancer
element
(GCCTAAGCCAAGTGATAAGCAGCCAGACAA), was purchased from Panomics. 9) The skeletal actin
promoter (∆394) was cloned by PCR from the mouse genome and cloned upstream of the luciferase
gene.
Chromatin immunoprecipitation-deep sequencing (ChIP-Seq) – C57/Bl mice were subjected to
either a sham or a transverse aortic constriction (TAC) operation. After 4d those hearts, in addition to a
1
CVR-2011-1122R1
pool of 1d old neonatal mice heart, were analyzed by chromatin immunoprecipitation using antipolymerase II antibody (Abcam ab5095) followed by deep sequencing (Genpathway Inc.). The number
of 36-nt sequence reads (tags) were: adult, 14862005; neonatal, 14928143; and hypertrophy, 17237721.
The data stored in a BAR (binary analysis results) file was viewed by Affymertrix’ Integrated Genome Browser
(IGB), which shows the the fragment density in 32-nt bins along the genome map. In addition, the average
fragment density of all bins present within the NCBI gene boundaries was calculated (Avg Value) and the ratio of
that for hypertrophy/adult or neonatal/adult normalized to that of GAPDH for a given gene is provided next to its
IGB screen shot.
Culturing cardiac myocytes and treatments - Cardiac myocytes were prepared as previously
described (24). Briefly, 1-2 day old Sprague-Dawley rats are euthanized by dislocation of the neck and
the hearts immediately removed through an incision left of the sternum. After dissociation the cardiac
myocytes were differentially separated by Percoll gradient centrifugation followed by a differential preplating step for further separation of non-cardiac cells.
Myocytes were then plated in Dulbecco’s
Modified Essential Medium/ Ham F12 (1:1) supplemented with 10% fetal bovine serum (complete
growth medium). Twenty-four hr after plating the medium is changed to complete growth medium of
serum-free medium, as indicated.
The cells at this time are either infected with recombinant
adenoviruses at a multiplicity of infection (moi) of 5-20 particles / cell and/or treated with 100 nM
endothelin-1, as indicated. Virus doses were equalized by a control virus expressing a nonsense stemloop sequence.
Northern Blotting - As described previously (23).
Western Blotting - Ten microgram of protein extract from cultured myocytes, or 25 µg from tissue,
were analyzed on 4-20% SDS-PAGE (Criterion gels; Bio-Rad). The primary antibodies used include:
anti-GATA4 (eBioscience), anti-PLCb1 (MYBioSource); anti-Actin (Millipore); anti-luciferase (Novus
Biologicals), anti-CARP (Santa Cruz), anti-myosin-heavy chain (MHC, MF-20) (Hybridoma Bank,
University of Iowa, IO), anti-slow skeletal myosin (Sigma-Aldrich), anti-p53 (GenScript). The secondary
2
CVR-2011-1122R1
antibodies were fluorescent IRDye-anti-IgG with emission wavelengths in the near-infrared (NIR)
spectrum, between 680 and 800 nm (LI-COR). The signal was detected by the Odyssey Imaging
System (LI-COR).
Immunocytochemistry - Myocytes were plated on gelatin-coated glass slides and treated as
described in the figure legends. The slides were then fixed in 3% paraformaldehyde plus 0.3% TritonX100 in CB buffer (10mM PIPES, 150mM NaCl, 5mM EGTA, 5mM MgCl2, 5mM Glucose, pH 6.1) for 5
minutes at 25°C followed by 3% paraformaldehyde in CB buffer for 20 minutes at 25°C. The cells were
immuno-labeled with anti-GATA4 (eBioscience) and anti-myosin heavy chain (MF-20) (Developmental
Studies Hybridoma Bank, University of Iowa, Iowa City, IA) in Tris-buffered saline with 1% bovine
serum albumin. Slides were mounted using Prolong Gold anti-fade plus 4,6-diamidino-2-phenylindole
(DAPI) (Invitrogen).
Luciferase assay - Cultured neonatal myocytes were infected with luciferase reporter vectors under
the conditions specified in each experiment. Protein was extracted after 24h and the luciferase activity
was measured using Luciferase Reporter Gene Assay, high sensitivity (Roche) and a Lmax multiwell
luminometer.
Exposing myoctyes to hypoxia – Cultured myocyte were placed in a sealed hypoxia chamber
(Billups-Rothenberg Inc., CA). The chamber was filled with a gas mixture of 95% N and 4.8% ± 0.2%
CO2 (Inhalation Therapy, NJ) at 7psi/12,000 kPa filing pressure for 15 minutes and sealed. The
chamber was then placed in a 37°C incubator for the required period.
Monitoring proteins synthesis - Protein was monitored by the incorporation of [3H]-leucine into total
cellular protein and normalized to the DNA content, as previously described 27.
Measurement of inositol trisphosphate – Myocytes were infected with Ad.miR-26b or a control virus
for 24 h before stimulating them with 10% fetal bovine serum or 100 nM ET-1 for 15 min. The cells
were harvested in phosphate-buffered saline and the IP3 measure by HitHunterTM Inositol (1,4,5)-
3
CVR-2011-1122R1
Trisphosphate Assay Fluorescence Polarization Detection kit as recommended by the manufacturer
(DiscoveRx).
“The assay is based on competitive binding between an IP3 fluorescent tracer and
unlabelled IP3 from cell lysates or standards. In the assay, induced cells are immediately quenched by
perchloric acid. Fluorescent IP3 tracer and the binding protein are subsequently added. IP3 from cell
lysates compete for binding to the IP3 binding protein. Bound IP3 tracer will “tumble” more slowly in
solution, creating a polarized signal (high mP)” copied from the manufacturer’s manual.
We also used a second method to measure IP3, which involves fractionation of [ 3H]-inositol-labeled
IPs. For this approach, myocytes were incubated with 2Ci/ml [3H]-myo-inositol (MP Biomedicals) in
complete growth medium for 48h. Cell were then serum-deprived for 8 h before stimulation with 10%
FBS or 100 nM ET-1 for 10 min. Cell were the extracted with 15% trichloroacetic acid (TCA). The
TCA was then removed by 3x diethyl ether extraction. The cellular extract containing the inositol
phosphates were fractionated on an anion-exchange chromatography, and sequentially eluted using
the following: 1) 2 x 2ml of water, free inositol, 2) 2 x 2ml of 60 mM-ammonium formate / 5 mMdisodium, 3) 2 x 2ml of 200 mM-ammonium formate / 100 mM-formic acid, IP1, 3) 3 x 2ml of 400 mMammonium formate/100mM-formic acid, IP2, 4) 4 x1ml of 1000 mM-ammonium formate / 100mMformic acid, IP3.
IP3 fractions were measured in the liquid phase 80% (v/v) Aquasol scintillation
cocktail, while all other fractions were measured in the gel phase 60%(v/v) Aquasol scintillation cocktail.
Real-time qPCR - Total RNA was extracted by TRIzol Reagent (Invitrogen). A two-step real-time PCR
was performed using High Capacity cDNA Reverse Transcription Kit and TaqMan® Gene Expression
Assay (Applied Biosystem) for mouse GATA4 assay Mm00484689_m1 (used for mice tissue), rat
GATA4
assay
Rn01530459_m1*
(used
for
rat
neonatal
myoytes),
mouse
CARP
assay
Mm01204056_g1, mouse ANF assay Mm01255747_g1, mouse Myh7 assay Mm00600555_m1, mouse
ACTA1 Mm00808218_g1, and mouse GAPDH assay Mm99999915_g1 (Applied Biosystem). A twostep real-time PCR for microRNA was performed using TaqMan® MicroRNA Reverse Transcription Kit
and TaqMan MicroRNA Assay for MiR26ab (Assay ID 000407), MiR199a5p (Assay ID 000498), MiR21
4
CVR-2011-1122R1
(Assay ID 000397), and U6 snRNA (Assay ID 001973) (Applied Biosystem).
Caspase Assay - Caspase-3 activity was measured using ApoTarget Caspase-3 Protease Assay
(Biosource, Invitrogen), as recommended by the manufacturer.
Construction of the miR-26 Transgenic Mouse - The miR-26 transgene was constructed using the
stem-loop precursor of mmu-miR-26b, cloned downstream of the 5.5 Kb α-myosin heavy chain
promoter and upstream of an SV40 polyadenylation signal. Two transgenic lines were generated at the
Transgenic Core Service, University of Medicine and Dentistry of New Jersey by Dr. Gassan Yehia. All
animal protocols were approved by the Institutional Animal Care and Use Committee at the New Jersey
Medical School.
Echocardiography - Mice were anaesthetized with 2.5% avertin (0.010 – 0.015ml/g body weight)
administered by intraperitoneal injection. The adequacy of the anesthetic is confirmed by the loss of
tongue retraction reflex. Transthoracic echocardiography (Sequoia C256; Acuson, Mountain View, CA)
was performed using a 13-MHz linear ultrasound transducer. The chest is shaved. Mice are placed on
a warm saline bag in a shallow left lateral position and warm coupling gel is applied to the chest.
Electrocardiographic leads are attached to each limb using needle electrodes. Two-dimensional images
and M-mode tracing (sweep speed = 100-200 mm/s) are recorded from the parasternal short-axis view
at the mid papillary muscle level. Care is taken not to apply too much pressure to the chest wall. The
images are recorded on videotape and freeze frames are printed on a Sony color printer, scanned into
PC using the Photoshop program (Adobe Photoshop). The images are then analyzed by NIH-Image
program. M-mode measurements of LV internal diameter (LVID) and wall thickness are made from 3
consecutive beats and averaged using the leading edge-to-leading edge convention adopted by the
American Society of Echocardiography. End-diastolic measurements are taken at the time of the
apparent maximal LV diastolic dimension. End-systolic measurements are made at the time of the most
anterior systolic excursion of the posterior wall. LVEF is calculated by the cubed methods as follows:
LVEF = LVIDd – LVIDs /LVIDd, where d indicates diastolic and s indicates systolic. LV percent fractional
5
CVR-2011-1122R1
shortening (LV FS) is calculated as LVFS% = [(LVEDD –
calculated from the period between two consecutive EKG tracing.
Hemodynamic measurements - Mice were anesthetized as described above, and a 1.4-French (Millar
Instruments) catheter-tip micromanometer catheter is inserted through the right carotid artery into the
aorta and then into the LV where pressures, dp/dt, and –dp/dt are recorded.
Transverse aortic constriction - Mice, 12 wk old, body wt 20-25 g, were anesthetized intraperitoneal
with a mixture of ketamine (65 mg/kg), xylazine (13 mg/kg), and acepromazine (2 mg/kg).
The
adequacy of the anesthetic was confirmed by the loss of tongue retraction reflex. The chest and neck
were shaved and mice were placed in the supine position. A midline cervical incision was made and the
same incision was extended about two-thirds of the way down toward the sternum. Two lobes of
salivary glands were separated to locate the trachea. Following application of 2% lidocaine jelly to the
vocal cord area, the trachea was intubated using a 20G plastic needle (aka angiocath or intracath
needle). Part of the pectoralis muscle was then detached from the sternum and other overlying muscles
were reflected toward the left side. The silicon, 20G intubation tubing, which was connected to the
angiocath needle, was then connected to a mechanical rodent ventilator. Mice were ventilated with a
tidal volume of 0.2-0.3 ml and a respiratory rate of 105-110 breaths per minute. Marcaine was locally
infiltrated to the sites lateral to the intended thoracotomy to achieve an intercostal nerve block just
above and below the ribs that are involved. Then the left chest was opened at the second intercostal
space, the internal mammary vessels were cauterized and the thymus glands were reflected superiorly.
The transverse thoracic aorta between the innominate artery and the left common carotid artery was
then dissected free. A 7-0 braided polyester suture was then tied around the aorta against a 26-30
gauge needle with the aid of an operating microscope, and then the needle was removed. The chest
was closed in layers with 5-0 or 6-0 nylon sutures and the pneumothorax was reduced using small
caliber tubing. The mice were extubated and allowed to recover in a Thermocare unit (temperature
88°F or 31°C; humidity 30-50%; oxygen 1-2 ml/min, low flow range). Warm saline (0.3-0.5 ml) was
6
CVR-2011-1122R1
given subcutaneously for fluid maintenance. Additional age-matched sham-operated control animals
underwent a similar surgery without constricting the aorta. Postoperative buprenorphine (0.01-0.05
mg/Kg) was administered subcutaneously every 12 h, as needed. Cardiac function was assessed after
2 weeks before the mice were sacrificed and the hearts harvested for analysis.
Statistics – For comparing 2 experimental groups, we used an unpaired, 2-tailed, Student t-test (Excel
software) for calculating the probability values. P < 0.05 was considered significant.
7