Supplemental Material
Increased Apoptosis Induction in Hepatocellular Carcinoma by a Novel
Tumor-Targeted TRAIL Fusion Protein combined with Bortezomib
Kristin Wahl,1 Martin Siegemund,2 Frank Lehner,3 Florian Vondran,3 Andreas Nüssler,4
Florian Länger,5 Til Krech,5 Roland Kontermann,2 Michael P. Manns,1
Klaus Schulze-Osthoff,6 Klaus Pfizenmaier,2 and Heike Bantel1
1
Department of Gastroenterology, Hepatology and Endocrinology, Hannover Medical School,
Hannover, Germany; 2Institute of Cell Biology and Immunology, University of Stuttgart,
Stuttgart, Germany; 3Department of Visceral and Transplantation Surgery, Hannover Medical
School, Hannover, Germany; 4Department of Trauma Surgery, University of Tübingen,
Tübingen, Germany; 5Department of Pathology, Hannover Medical School, Hannover,
Germany;
6
Interfaculty Institute of Biochemistry, University of Tübingen, Tübingen,
Germany
Material and Methods
Preparation of TRAIL fusion proteins
The pIRESpuro-scTRAIL expression construct for human scTRAIL was obtained by
EcoRI/NotI cloning of a synthesized sequence encoding three TRAIL modules (aa residues
95-281) connected by (GGGS)2 linkers into a construct described previously (Schneider et al.,
2010). For generation of the EGFR-specific pCR3-scFv-scTRAIL expression construct
(EGFR-scTRAIL), a synthesized coding sequence of a humanized scFv ‘huC225’ derived
from the EGFR antibody cetuximab (own unpublished data) was amplified using the
oligonucleotides CGAGGTGCAGCTGGTCGAG and TGCGGCCGCTCTCTTGATTTC.
This
template
was
annealed
with
the
oligonucleotide
ATATATCTCGAGGCCAGCGACTACAAAGACGATGACGATAAAGGAGCCGAGGTG
CAGCTGGTCGAG to insert an XhoI site and a FLAG tag coding sequence. After strand
elongation,
the
oligonucleotides
ATATATCTCGAGGCCAGCGAC
and
ATATGAATTCTGCGGCCGCTCTCTTGATTTC were used for PCR. The product was
cloned via XhoI/EcoRI into pCR3 (Invitrogen, Darmstadt; Germany), carrying a VH leader
and a dummy scFv-scTRAIL sequence. The scTRAIL-coding sequence was then substituted
via EcoRI/XbaI cloning, using the same sequence as for scTRAIL expression. TRAIL
proteins were produced in HEK293 cells and purified from supernatants by immobilized
metal affinity chromatography followed by affinity chromatography on anti-FLAG mAb M2
agarose (Sigma-Aldrich, Steinheim, Germany).1-2
Cell viability assays
After incubation of PHHs or Huh7 cells with the different stimuli cell viability was measured
by MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) colorimetric assay.
MTT (50 µg/well; Sigma-Aldrich) was added to the cells for 4 hours at 37°C, before
supernatants were removed and cells were lysed with 95% isopropanol/5% acetic acid.
Absorption was measured at 550 nm. Alternatively, cell viability was measured by the
standard crystal violet assay. Cells were stained with 20% methanol containing 0.5% crystal
violet and solubilized in 33% acetic acid. The absorbance was measured at 590 nm. Values of
untreated cells represented 100% viability.
Caspase activity assays
Following incubation with the respective agents, liver tissue was pulverized in liquid nitrogen.
Pulverized liver tissue, hepatoma cells and PHHs were lysed in a cocktail of 0.5% Nonidet P40, 10 mM Tris-HCl pH 7.4, 10 mM MgCl2, 150 mM NaCl, 10 mM dithiothreitol, and 1%
protease inhibitor (Sigma-Aldrich). After 30 min of incubation on ice, the lysates were cleared
by centrifugation and measured for protein content by the bicinchoninic acid assay (Thermo
Scientific, Braunschweig, Germany). Activity of caspase-3 and caspase-7 was measured in
duplicate by a luminescent substrate assay (Caspase-Glo, Promega, Mannheim, Germany) as
described.3 The assay provides a luminescent substrate with the caspase cleavage sequence
DEVD in a reagent optimized for caspase activity and luciferase activity. Following cleavage
of the substrate at the DEVD peptide by activated caspase-3 and caspase-7, aminoluciferin is
released, resulting in light production in a luciferase reaction, which can be measured in
relative light units (RLU) by a luminometer. First, cell extracts were diluted in 50 mM TrisHCl (pH 7.4), 10 mM KCl, and 5% glycerol to reach a final protein concentration of 1 mg/mL.
Then, 10 µl of the extracts were incubated with 10 µl of the caspase substrate DEVD-luciferin
and luciferase reagent for 2 hours at room temperature. Luminescence of the samples was
measured in duplicate in a luminometer (LB 960, Berthold, Bad Wildbad, Germany) and
calculated as the increase relative to that of the untreated control.
Immunoblotting
Proteins were separated under reducing conditions on a 12% SDS-polyacrylamide gel and
electroblotted to a polyvinylidene difluoride membrane (BioRad, Munich, Germany).
Membranes were blocked for 1 hour with 5% nonfat dry milk powder in Tris-buffered saline
(TBS: 20 mM Tris-HCL pH 7.5, 150 mM NaCl) and then incubated overnight at 4°C with
anti-caspase-8 antibody (BioCheck, Münster, Germany) and anti-glycerinaldehyde-3phosphate-dehydrogenase antibody (GAPDH; Cell Signaling Technology) as control.
Membranes were washed with TBST (TBS with 0.2% Tween-20) and incubated with the
horseradish peroxidase-conjugated secondary antibodies for 1 hour. Following extensive
washing, the reaction was developed by enhanced chemiluminescent staining (GE Healthcare,
Munich, Germany).
Immunohistochemistry
Frozen sections (10 µm) of healthy or HCC liver explants, either untreated or treated with the
different agents, were stained for active caspase-3 using an anti-cleaved caspase-3 (Cell
Signaling Technology, Danvers, MA, USA) or caspase-cleaved cytokeratin-18 antibody (M30,
Roche, Mannheim, Germany). The sections were fixed in acetone, followed by washing in
Tris-HCl (pH 7.4). Following inhibition of endogenous peroxidase, nonspecific binding was
blocked with 1% bovine serum albumin for 1 hour. Sections were then incubated overnight at
4°C with anti-cleaved caspase-3 or M30 antibodies. After repeated washing, sections were
incubated for 30 minutes with biotinylated secondary antibody and covered for 1 hour with
avidin-biotin complex reagent (ABC kit, Vector Laboratories, Burlingame, CA). Finally, the
sections were stained in aminoethylcarbazole solution and counterstained with hematoxylin.
For TUNEL staining (cell death detection kit, Roche) frozen sections were permeabilized for
30 minutes with 0.1 % Triton X-100 in 0.1% sodium citrate (pH 4.7), washed in PBS and then
incubated for 1 hour at 37°C in a reaction mixture (200 mM potassium cacodylate, 25 mM
Tris-HCl pH 6.6, 1 mM cobalt chloride, 0.25 mg/mL bovine serum albumin) containing
terminal deoxynucleotidyl transferase (0.2 U/µl) and fluorescein isothiocyanate-labeled
deoxyuridine triphosphate.4 Sections were embedded in fluorescence-mounting medium
containing DAPI (4’,6-diamidino-2-phenylindole; Vector Laboratories). Paraffin sections
were deparaffinised and stained for EGFR expression using the antibody 2-1E1 (1:200,
Zytomed, Berlin, Germany) according to standard procedures.
Supplemental References
1. Schneider B, Münkel S, Krippner-Heidenreich A, Grunwald I, Wels WS, Wajant H, et al.
Potent antitumoral activity of TRAIL through generation of tumor-targeted single-chain
fusion proteins. Cell Death Dis 2010; doi:10.1038/cddis.2010.45
2. Siegemund M, Pollak N, Seifert O, Wahl K, Hanak K, Vogel A, et al. Superior
antitumoral activity of dimerized targeted single-chain TRAIL fusion proteins under
retention of tumor selectivity. Cell Death Dis 2012; doi:10.1038/cddis.2012.29
3. Seidel N, Volkmann X, Länger F, Flemming P, Manns MP, Schulze-Osthoff K, et al. The
extent of liver steatosis in chronic hepatitis C virus infection is mirrored by caspase
activity in serum. HEPATOLOGY 2005;42:113-120.
4. Volkmann X, Fischer U, Bahr MJ, Ott M, Lehner F, MacFarlane M, et al. Increased
hepatotoxicity of tumor necrosis factor-related apoptosis-inducing ligand in diseased
human liver. HEPATOLOGY 2007;46:1498-1508.