Your Genetic Code and Class Hypotheses
Look at the polypeptide that you translated from the sequence in the previous assignment.
AUGCCCGUAGCCAGUGCCCAGUCGGAAUGGUGA
Would you expect this to be the same as the polypeptide anyone else in the class got? Why or why not?
Suppose, when the instructor was grading the previous assignment, it was found that two students had the
same polypeptide, and exactly the same genetic code table. What would the instructor think had happened?
(See mathematical note below.)
Mathematical note: How many different possible ways are there to fill out the genetic code table? There would be approximately 20! [20 factorial,
or about 2 x 1018 ] ways to put each amino acid in one blank, if each had only one codon). Twenty factorial is 2 quintillion, or 2 billion billion
possibilities.
In the biological terms, would this similarity (two of you come up with the same genetic code table) be
homology (came from a common source) or analogy (had to be that way)? Explain.
Now, to relate this to the class hypotheses: Consider the old three main types of hypotheses in the class.
Which of the three would predict that there would be any homology between plants and humans? Explain.
It is possible to isolate ribosomes and tRNAs from wheat seeds and put them in solution in a test tube. If GTP
(for energy - works like ATP, but it's used in translation instead of ATP) and a wheat mRNA are added,
translation occurs, and a wheat protein will be synthesized. Suppose you took a test tube with wheat
ribosomes, wheat tRNAs and GTP, and added a human mRNA. Would a human protein be synthesized?
Would it be the same as the protein made from that RNA in a human? Explain what you think.
Universality
In fact, this technique is routinely used to translate mRNAs from all sorts of organisms in laboratories. Wheat
germ ribosomes and tRNAs work fine to translate human mRNAs, and give proteins which are identical to the
proteins synthesized in humans. Even bacteria can transcribe and translate genes from plants and animals.
For instance, the gene for human insulin, a polypeptide hormone, has been inserted into the DNA of the
bacterium E. coli. These recombinant bacteria are grown in vats, where they produce large quantities of
insulin, which is then extracted and sold by pharmaceutical companies for use by diabetics.
Every organism on Earth that has been studied has the same genetic code, with a few partial exceptions. A
few very strange bacteria which live in places like hot sulfur springs, and the mitochondria and chloroplasts
within cells of higher plants and animals, have some differences. However, even these differ only in one or two
codons. No organism has a genetic code that differs from the standard by more than two codon assignments
out of the 64.
In the rest (the vast majority of organisms), their genetic code is identical to that of every other organism. The
genetic code is thus said to be universal. This genetic code is exactly the same in all of the organisms that
are found in your phylogenetic trees, for instance.
Assignment:
Is the identical genetic code in E.coli, humans, bison, maple trees, mushrooms, and flies (among others) an
example of homology or analogy? Use the standard procedure for constructing arguments about homology
and analogy and give a COMPLETE argument for this. Don't just write a couple of sentences.