Plasmid and strain conctructions.
All plasmid constructions were made in E. coli JM105. For construction of the
pCB301-plasmid series, internal fragments of dnaB genes carrying various mutations
were generated by PCR using oligonucleotides OdnaB1 and OSMG10 as primers, and
chromosomal DNA of strains 168 (DnaB+), CBB295 (dnaB116), CBB296 (dnaB118),
and CBB298 (dnaB123) as templates. These fragments were blunted and inserted into
the SmaI site of plasmid pBS-Spec.
For construction of plasmid pCB321, a PCR fragment was produced using the
replicative form of the M13-mp19 bacteriophage derivative PFE3 as template, and
standard sequencing primers (New England Biolabs #1201 and 1211). This fragment
was blunted and inserted in the StuI site of plasmid pMTL20E. A SmaI fragment from
plasmid pIC156 carrying a SpcR gene was then inserted at the unique BclI site of the
resulting plasmid, giving plasmid pCB321.
Plasmids pCB323 and pCB327 are derivatives of plasmid pMUTIN2, containing
DNA fragments generated by PCR using B. subtilis 168 chromosomal DNA as
template and the pairs of oligonucleotides OCB109-110 and OCB111-112 as primers,
respectively.
For construction of pCB323, the PCR fragment generated using primers OCB109-110
was digested with EcoRI-BamHI and cloned into the EcoRI-BamHI digested
pMUTIN2. In pCB327, the PCR fragment generated using OCB111-112 was blunted
and inserted in the proper orientation into the BamHI (blunted) site of pMUTIN2.
For construction of pCB326, a PCR fragment was generated using chromosomal
DNA of strain CBB462 as template and oligonucleotides OCB113 and Ospac as
primers. This fragment was blunted and inserted into the BamHI (blunted) site of
pDH32. In this plasmid, orientation of transcription of the Pspac-dnaD fusion is
opposite to that of amyE.
CBB462 and 464 were obtained by transformation of strain 168 and CBB301,
respectively, to EmR with plasmid pCB323, followed by transformation of the
resulting strains with the LacI-overproducing plasmid pMAP65 (to tightly regulate
the Pspac promoter). Proper integration of pCB323 was checked by Southern blot.
CBB482 resulted from transformation of strain 168 to EmR with plasmid pCB327,
followed by transformation of the resulting strain with pMAP65. Proper integration of
pCB327 was checked by Southern blot. CBB488 was constructed by transforming
strain 168 to CmR with plasmid pCB326. Double-crossing over integration of the
plasmid was screened by looking for amy+ clones. Proper double cross-over
integration of the plasmid was checked by Southern blot. CBB671 was constructed by
transforming strain L1434 to CmR with plasmid pSG05. PPBJ128 was constructed by
transforming strain 168 with chromosomal DNA of strain L1434, selecting for trp+
phenotype, then screening transformants for temperature sensitive colonies.
For construction of pSMG39, the dnaD23 coding sequence was PCR-amplified from
chromosomal DNA of B. subtilis strain L1434 with OSMG91 and OSMG92 primers,
digested with SbfI and HindIII, and inserted in plasmid pDG148 cleaved with the
same enzymes.
pSMG22-D23 plasmid was constructed exactly as pSMG22 (see Marsin et al., 2001),
except that chromosomal DNA from L1434 strain was used to generate the PCR
fragment carrying the dnaD23 coding sequence.
Plasmid pSMG37 expresses DnaB. For its construction, the dnaB coding sequence
was PCR-amplified from the B. subtilis genome (strain 168) with OSMG9 and
OSMG87 primers, digested with NdeI and NsiI and inserted in pTYB1 cleaved by the
same enzymes (deleting thereby the intein-CBD sequence of the plasmid). Plasmid
pCS1 expresses B. subtilis SSB under the control of the T7 transcriptional and
translational signals present in the pTYB1 vector. It was constructed like pSMG37
with the use of OSMG18 and OCES1 primers to amplify SSB coding sequence from
the B. subtilis genome (168).
Protein purification
Wild-type DnaB was expressed from pSMG37 in E. coli ER2566. An overnight
culture grown at 30°C in 500 ml of LB-AT (LB medium supplemented with thymine
25 mg/ml and ampicillin 100 µg/ml) was transferred at 20-25°C. Over-expression was
induced by adding 0.5 mM IPTG and the culture was further grown for 6 hours at 2025°C. Harvested cells were incubated for 30 min at 4°C in lysis buffer (25 mM TrisCl [pH 8], 0.2 M NaCl, 10 mM DTT) supplemented with 0.5 mg/ml of lysozyme.
After a freeze-thaw step, the lysate was centrifuged at 150,000 g at 4°C for 1h30.
Soluble DnaB was then precipitated with 40% ammonium sulfate (AS) and
resuspended in 10 ml of buffer A (50 mM Tris-Cl [pH 8], 1 mM DTT) containing
30% AS. DnaB was then injected on a 5 mL HiTrap Phenyl sepharose column
equilibrated in buffer A containing 30% AS. After washing with 8 column volumes
with the same buffer, DnaB was eluted with a gradient in buffer A from 9% to 0 %
AS over 15 column volumes. The fractions containing DnaB were pooled and loaded
on a 5 ml HiTrap Q column in buffer A containing 20 mM NaCl. DnaB was then
eluted with a gradient in buffer A from 20 mM to 2 M NaCl over 15 column volumes.
The fractions containing DnaB were pooled and diluted 2 fold in buffer A before
loading on a 1 ml HiTrap SP column equilibrated in buffer A containing 20 mM
NaCl. DnaB was eluted as in the previous step.
Wild-type SSB was expressed from pCES1 in E. coli ER2566. A culture was grown
overnight at 37°C in 250 ml of LB-AT. Harvested cells were incubated for 30 min at
4°C in 10 ml of lysis buffer (25 mM Tris-Cl [pH 8], 0.2 M NaCl, EDTA 0.2 M, 10
mM DTT) supplemented with 0.5 mg/ml of lysozyme. After a freeze-thaw step, cells
were broken by sonication (Bioblock Vibracell 72408 sonicator, used as
recommended by the supplier). The lysate was then centrifuged at 30,000 g at 4°C for
30 min. The pellet, containing SSB, was resuspended in buffer A containig 1 M NaCl,
and centrifuged again (30,000 g at 4°C for 1 hour). The supernatant was then
submitted to a 20% AS precipitation, and the pellet was washed with the same buffer.
The AS pellet was resuspended in 10 ml of buffer A containig 1 M NaCl, and loaded
onto a PD10 column equilibrated in buffer A containig 0.25 M NaCl. SSB was then
loaded on a 1 ml HiTrap Q column equilibrated in the same buffer, and eluted with a
gradient in buffer A from 0.25 M to 2 M NaCl over 15 ml. The fractions containing
SSB were then loaded on a Superdex 200 Hiload 26/60 column (APB) equilibrated in
1 M NaCl.
All purified proteins were stored at -20°C in 50% glycerol. The identity of the
purified proteins was confirmed by mass spectroscopy (MALDI-TOF) following
trypsinolysis.
Oligonucleotides
Sequences complementary to the templates used for PCR experiments are italicized, and restriction
sites, when used for cloning, are underlined. When applicable, coordinates of the sequence are given in
parentheses, giving the value +1 to the first nucleotide of start codon.
OCB109 : 5’ CCGGAATTCCTTTACAGTAAGAGGTG (dnaD -24/-6)
OCB110 : 5’ CGCGGATCCCCTTCTGCTTTTCTTTCC (dnaD +374/+354)
OCB111 : 5’ CCGGAATTCAATAAAGTGAAAAGGTGA (nth -15/+4)
OCB112 : 5’ CGCGGATCCGGATACCACTACGTTTGCGG (nth +394/+374)
OCB113 : 5’ CACTTTATTGTTCAAGCC (dnaD +703/+686)
OCES1 : 5’ CGCGATGCATTAGAATGGAAGATCATCATCCG 3’ ( ssb +519/+496)
Ospac : 5’ TAACAGCACAAGAGCGG
OdnaI3 : 5’ AGATGATGGAAGAAATGC (dnaI -74/-57 )
OdnaI4 : 5’ GACAGCCGTTTTTCGTTTC (dnaI +990/+972)
OSMG9 : 5’ GAATTCCATATGGCTGACTATTGGAAAGAT (dnaB +1/+21)
OSMG10: 5’GAATTCGCTCTTCCGCAATAGGCAGAGTATTTTTTCAGTT
(dnaB +1417/+1394)
OSMG18: 5’ GAATTCCATATGCTTAACCGAGTTGTATTAG 3’ (ssb +1+22)
OSMG87 : 5’GCAGCATGCATTAATAGGCAGAGTATTTTTTCAG 3’ (dnaB +1417/+1396)
OSMG91 : 5’GACCAGCCTGCAGGTTATTGTTCAAGCCAATTGTAA (dnaD + 700/+678)
OSMG92 : 5’GACCAGAAGCTTAGGGGCAATCACAATCCTT (dnaD –20/-38)
OdnaB1 : 5’ CCGGAATTCTGAATGGAAGCTCACATCCG (dnaB +513/+532)
OdnaB2 : 5’ CGCGGATCCTGATACCAGTCGCTCGCCGC (dnaB +808/+827)
References
Bruand, C., Sorokin, A., Serror, P., and Ehrlich, S.D. (1995) Nucleotide sequence of
the Bacillus subtilis dnaD gene. Microbiology 141: 321-322.
Bruand, C., Farache, M., McGovern, S., Ehrlich, S.D., and Polard, P. (2001) DnaB,
DnaD and DnaI proteins are components of the Bacillus subtilis replication restart
primosome. Mol Microbiol 42: 245-255.
Joseph, P., Fantino, J.R., Herbaud, M.L., and Denizot, F. (2001) Rapid oriented
cloning in a shuttle vector allowing modulatedgene expression in Bacillus subtilis.
FEMS Microbiology Lett 205: 91-97
Mauël, C. and Karamata, D. (1984) Prophage induction in temperature sensitive DNA
mutants of Bacillus subtilis. Mol Gen Genet 194: 451-456.
Marsin, S., McGovern, S., Ehrlich, S.D., Bruand, C., and Polard, P. (2001) Early steps
of Bacillus subtilis primosome assembly. J Biol Chem 276: 45818-45825.
Petit, M.A., Dervyn, E., Rose, M., Entian, K.D., McGovern, S., Ehrlich, S.D., and
Bruand, C. (1998) PcrA is an essential DNA helicase of Bacillus subtilis fulfilling
functions both in repair and rolling-circle replication. Mol Microbiol 29: 261-273.
Pujol, C., Chédin, F., Ehrlich, S.D., and Jannière, L. (1998) Inhibition of a naturally
occurring rolling-circle replicon in derivatives of the theta-replicating plasmid
pIP501. Mol Microbiol 29: 709-718.
Shimotsu, H., and Henner, D.J. (1986) Construction of a single-copy integration
vector and its use in analysis of regulation of the trp operon of Bacillus subtilis. Gene
43: 85-94.
Steinmetz, M., and Richter, R. (1994) Plasmids designed to alter the antibiotic
resistance expressed by insertion mutations in Bacillus subtilis, through in vivo
recombination. Gene 142: 79-83.
Swinfield, T.J., Oultram, J.D., Thompson, D.E., Brehm, J.K., and Minton, N.P.
(1990) Physical characterisation of the replication region of the Streptococcus faecalis
plasmid pAM1. Gene 87: 79-90.
Vagner, V., Dervyn, E., and Ehrlich, S.D. (1998) A vector for systematic gene
inactivation in Bacillus subtilis. Microbiology 144: 3097-3104.