1 Supplementary Information 2 Supplemetary Table 1. Collection and voucher information for samples used in this study. All host genera are Tsuga. Voucher Accession No. Sample name CNC HEM053427 NH04-85 Host species Collection information TAIWAN, Taichung Co., Tayuling; 23 Dec. 2004; Coll. H.Y. Wang YPM ENT 764423 Ad03-01 YPM ENT 674511 Ad02-05 T. chinensis var. formosana T. chinensis T. chinensis CNC HEM053081 Ad02-10 T. chinensis YPM ENT 764508 Ad02-34 T. chinensis CNC HEM053368 NH04-35 T. diversifolia CNC HEM053369 NH04-36 T. diversifolia CNC HEM053370 NH04-37 T. diversifolia CNC HEM053390 NH04-44 T. diversifolia CNC HEM056237 Ad06-20 T. diversifolia CNC HEM056235 Ad06-22 T. diversifolia CNC HEM053366 NH04-33 T. seiboldii CNC HEM053367 NH04-34 T. seiboldii CNC HEM053364 NH04-31 T. sieboldii CNC HEM053432 NH05-04 T. sieboldii CHINA, Qioji, Boaxing Co., Sichuan; 28 Sep. 2003; Coll. M.E. Montgomery CHINA, Shaanxi, Ningshan Co.; 13 Oct. 2002; Coll.: N.P. Havill, M.E. Montgomery, G. Yu CHINA, Shaanxi, Ningshan Co.; 13 Oct. 2002; Coll. N.P. Havill, M.E. Montgomery, G. Yu CHINA, Yunnan, Lijiang Co.; 25 Oct. 2002; Coll. N.P. Havill JAPAN, Nagano Prefecture, Tashirobashi, Kamikochi, Azumi-mura; 10 June 2004; Coll. N. Havill, S. Shiyake, G. Yu JAPAN, Gifu Prefecture, Norikura skyline, Kamitakara-mura; 10 June 2004; Coll. N. Havill, S. Shiyake, G. Yu JAPAN, Gifu Pref., Norikura Skyline, Kamitakara-mura; 10 June 2004; Coll. N. Havill, S. Shiyake, G. Yu JAPAN, Yamanashi Prefecture, Mt. Fuji; 12 June 2004; Coll. N. Havill, S. Shiyake, G. Yu JAPAN, Nagano Prefecture; Ina; Mibu Valley; 10 May 2006; Coll. M.E. Montgomery, S. Shiyake JAPAN, JAPAN; Nara Pref.; Nakamichi; Odaigahara; 8 May 2006; Coll.: Y. Miyataki JAPAN, Osaka Prefecture, Yoshikawa, Toyono-cho; 9 June 2004; Coll. N. Havill, S. Shiyake, G. Yu JAPAN, Osaka Prefecture, Nakahata, Takatsuki; 9 June 2004; Coll. N. Havill, S. Shiyake, G. Yu JAPAN, Wakayama Prefecture, Kongo-buji Temple, Koya-san; 8 June 2004; Coll. N. Havill, S. Shiyake, G. Yu JAPAN, Shizuoka Prefecture, Yugashima, Izu-shi; 19 March 2005; Coll. S. Shiyake YPM ENT 764514 Ad06-04 T. sieboldii YPM ENT 764528 Ad04-13 YPM ENT 764529 Ad04-14 CNC HEM053412 Ad04-18 T. canadensis T. canadensis T. canadensis YPM ENT 764530 Ad05-13 YPM ENT 764498 AdNANY1 T. canadensis T. canadensis JAPAN, Osaka Prefecture, Takatsuki, Fuji shrine; 24 March 2006; Coll. A. Lamb, S. Shiyake, T. McAvoy JAPAN, Kyoto Prefecture, Kameoka, Uketa shrine; 28 March 2006; Coll. A. Lamb, S. Shiyake, T. McAvoy JAPAN, Nara Prefecture, Nara, Wakakusa-Yama; 17 April 2006; Coll. A. Lamb, S. Shiyake, T. McAvoy JAPAN, Wakayama Prefecture, Koya, Ojiyama san; 17 April 1996; Coll. A. Lamb, S. Shiyake, T. McAvoy JAPAN, Wakayama Prefecture, Koya-san town; 23 Sep. 2003; Coll. M.E. Montgomery; S. Shiyake USA, CT, New Haven Co., Hamden; 6 Nov. 2003; Coll. K. Shields USA, CT, New Haven Co., Hamden; 3 Dec. 2003; Coll. K. Shields USA, CT, Litchfield Co., Bridgewater; 15 June 2002; Coll.: N.P. Havill USA, CT, Middlesex Co., Killingworth, Chatfield Hollow State Park; 26 June 2003; Coll. D. Mikus USA, CT, Middlesex Co., Killingworth, Chatfield Hollow State Park; 26 June 2003; Coll. D. Mikus USA, CT, Middlesex Co., Killingworth, Chatfield Hollow State Park; 26 June 2003; Coll. D. Mikus USA, CT, New Haven Co., Hamden; 23 July 2003; Coll. K. Shields USA, CT, New Haven Co., Hamden; 6 Feb. 2004; Coll. K. Shields USA, CT, New Haven Co., Hamden; 9 Feb. 2005; Coll. K. Shields USA, CT, Middlesex Co., Killingworth; 27 Oct. 2005; Coll. K. Shields USA, CT, New Haven Co., Hamden; 26 April 2006; Coll. K. Shields USA, GA, Clayton Co., Chattahoochee Nat. For.; Reed Creek Gap; 11 May 2004; Coll. M.E. Montgomery USA, MA, Suffolk Co., Jamaica Plain; Arnold Arboretum; 23 June 2003; Coll. N.P. Havill USA, MD, Allegheny Co., Flintstone; 18 March 2004 USA, NC; 18 March 2004; Coll. R. Rhea USA, NC, Otto Co., Hurricane Gap, Coweta Hydrologic Lab; 12 May 2004; Coll. M.E. Montgomery USA, NC; 26 Oct. 2005; Coll. R. Rhea USA, NY, Ulster Co., Ashokan; 11 Dec. 2001; Coll. L. Jones YPM ENT 764515 Ad06-07 T. sieboldii YPM ENT 764516 Ad06-14 T. sieboldii YPM ENT 764517 Ad06-15 T. sieboldii CNC HEM053336 AdJ1 T. sieboldii YPM ENT 764518 YPM ENT 764519 YPM ENT 764496 YPM ENT 764520 AdCT03 AdCT04 AdNACT25 Ad03-01 T. canadensis T. canadensis T. canadensis T. canadensis CNC HEM053347 T. heterophylla USA, OR, Clackamas County, Sandy; 17 Dec. 2003; Coll. B. Wilhite YPM ENT 764521 Ad03-03 T. canadensis YPM ENT 764522 Ad03-04 T. canadensis YPM ENT 764523 YPM ENT 764524 YPM ENT 764525 YPM ENT 764526 YPM ENT 764527 CNC HEM053410 Ad03-06 Ad04-03 Ad05-01 Ad05-11 Ad06-18 Ad04-17 T. canadensis T. canadensis T. canadensis T. canadensis T. canadensis T. canadensis CNC HEM053181 AdNAAA T. seiboldii Ad04-04 YPM ENT 764531 YPM ENT 764532 YPM ENT 764503 YPM ENT 764533 YPM ENT 764534 YPM ENT 764535 CNC HEM053161 YPM ENT 764536 YPM ENT 764537 YPM ENT 764538 CNC HEM053405 YPM ENT 764539 CNC HEM053422 YPM ENT 764540 YPM ENT 764541 YPM ENT 764542 YPM ENT 764543 Ad04-05 Ad04-06 Ad04-07 Ad05-12 Ad06-12 AdOR2 AdNAWA1 Ad04-08 Ad04-09 Ad04-10 Ad04-11 Ad04-19 Ad04-25 Ad03-08 Ad03-09 Ad03-10 Ad03-11 T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla T. heterophylla USA, OR Clackamas County, Sandy; 3 Feb. 2004; Coll. B. Wilhite USA, OR Clackamas County, Sandy; 3 March 2004; Coll. B. Wilhite USA, OR, Clackamas Co., Sandy; 5 April 2004; Coll. B. Wilhite USA, OR, Benton Co., Corvallis; 27 Oct. 2005 USA, OR, Eola Hills; 11 April 2006 USA, OR, Clackamas Co., Sandy; 18 Nov. 2003; Coll. B. Wilhite USA, WA, Clark Co., Vancouver, Ridgefield; 5 May 2003; Coll.: N.P. Havill USA, WA; 15 April 2004 USA, WA, King County; 28 April 2004 USA, WA, Thurston County; 28 April 2004 USA, WA, Clallam Co., Sequim, Dungeness NWR; 27 April 2004; Coll. K. Ripley USA, WA; 15 April 2004 USA, WA, Snohomish Co., Edmonds; 30 Sep. 2004; Coll. K. Saltonstall CANADA, Pacific Forestry Centre, Victoria; 14 Nov. 2003 CANADA, Pacific Forestry Centre, Victoria; 14 Nov. 2003 CANADA, British Columbia, Victoria; 3 Dec. 2003 CANADA, Pacific Forestry Centre, Victoria; 14 Nov. 2003 Supplementary Table 2. Primers and probes used in this study. Primer/Probe Name 10f 27f 340f 341f 570r 766f 810r (ER15) 1495r 1507r AT Beta 70Ar AT Beta 70Br AT Beta 191Ar AT Beta 191Br AT Beta 440Ar AT Beta 440Br AT Beta 844Ar AT Beta 844Br AT Beta 1032Ar AT Beta 1032Br AT Beta 1256Ar AT Beta 1256Br AT BetaA 1009r AT BetaB 1009r AT BetaA 460f AT BetaB 460f AT BetaA 460r AT BetaB 460r BetaA 74r BetaA 454r BetaA 836r BetaA 1003r BetaA 1021r BetaB 74r Sequence (5' - 3') AGTTTGATCATGGCTCAGATTG GAGAGTTTGATCCTGGCTCAG TTCTAAGGAAGGCAGCAGTG CCTACGGGAGGCAGCAGTGG CGCCCTGTAATTCCGATTAACGC AAAGCGTGGGGAGCAAACAG GCGTGGACTACCAGGGTATC CTACGGCTACCTTGTTACGA TACCTTGTTACGACTTCACCCCAG CAGCGCGGGGCAACCTGGC CAGCACGGGGGCAACCCTGGT GATGAAAGTGGGGGACCTTC GAAGAAAGCGGGGGATCTTT TGTCAGGGAAGAAACGGCCGA TGTCCGGAAAGAAAACCTTTT AATTAACTTGGTAACGCAGC CATTGACTTAGTAACGTAGC CCGAAAGGGAACCTGAAC TCGAAAGAGAACCGATAC CCGCCAACCCGCGAGGGG CTGCCAACCCGTGAGGGG CCTTTCAGCCAGGTTCCGACC GATCTCTCCGGACTTCCTGAC ACCTTTTGGTTAATACCCGAGGGG CGGCCGAGGATAATACCTTTGGCT CCCCTCGGGTATTAACCAAAAGGT AGCCAAAGGTATTATCCTCGGCCG ACGGGGGCAACCCTGGT ACCTTTTGGTTAATACCCGAGG TGGGTCTTCATTGACTTAGTAACGT GTCGGAGCCTGGCTGAAA GCTGGGGTGCTCGAAAGAG GCGGGGCAACCTGGC Reference/Target taxon (Munson et al., 1991)/general eubacterial (Lane, 1991)/general eubacterial (Spaulding and von Dohlen, 2001)/general eubacterial (Spaulding and von Dohlen, 1998)/general eubacterial This study/general eubacterial (Spaulding and von Dohlen, 1998)/general eubacterial (Widjojoatmodjo et al., 1995)/general eubacterial (Adolph, 1996)/general eubacterial (Munson et al., 1991)/general eubacterial This study/BS1 This study/BS2 This study/BS1 This study/BS2 This study/BS1 This study/BS2 This study/BS1 This study/BS2 This study/BS1 This study/BS2 This study/BS1 This study/BS2 This study/BS1 This study/BS2 This study/BS1 This study/BS2 This study/BS1 This study/BS2 This study/BS1 This study/BS1 This study/BS1 This study/BS1 This study/BS1 This study/BS2 BetaB 443r BetaB 454r BetaB 836r BetaB 1003r GamA 805r GamB 1119r GamB 437f GamB 807r GamC 440r GamC 476f GamC 476r GamC 847r GamC 1256 GANA 192r GANA 1118r CAGGGAAGAAACGGCCGA CGGCCGAGGATAATACCTTT CGGGTTTTAATTAACTTGGTAACGC ATCTCTCCGGACTTCCTGA CTTCTAACGGCTAGTTGA GAGTTCCCGACTTTATCG GCAATGTCTTATTAACACATTACC GGGCACAACCTCCAAATC CAATAGCATAAGAAGGTAATGAAA ATTTTGTTATCAGACGTTAGCTAT ATAGCTAACGTCTGATAACAAAAT ATTATAAGTCAAAGCTTT ATGCAATATTGTAAAATA TGATAGTGCAAGGCCTTG GAGTGCCCACCATGATGT This study/BS2 This study/BS2 This study/BS2 This study/BS2 This study/GS-A This study/GS-B This study/GS-B This study/GS-B This study/GS-C This study/GS-C This study/GS-C This study/GS-C This study/GS-C This study/GS-A This study/GS-A Supplementary Figure Legends Figure S1. Maximum-parsimony phylogram of Gammaproteobacteria GS-B (‘Ca. Serratia symbiotica’) sequences amplified from Japanese T. sieboldii populations from the island of Honshu and from eastern North American populations; all other samples yielded no amplifications of that phylotype. Numbers above branches indicate inferred substitutions along the branch. GenBank accessions are indicated in brackets. Figure S2. Laser-scanning confocal images from FISH with the general eubacterial probe 1507r (labeled with A-568). A. Japanese sample from T. sieboldii first-instar stage, showing probed bacteria (in red) in both the body cavity and salivary glands. Inset: high magnification of a probed salivary gland. B. Same sample as in A, but different insect; no differentiated bacteriome is visible. C. Japanese sample from T. sieboldii, fourth-instar or adult stage, showing probed bacteria in the hemocoel and the central region of a bacteriome; insets: high magnification of bacteriome-dwelling bacteria and hemocoel bacteria. D. Western North America sample from T. heterophylla, third-instar stage cross-section, showing probed rod-shaped bacteria (in red) in the hemocoel and completely filling several bacteriocytes. Green = autofluorescence from insect tissue. b = bacteriome, s = salivary gland, h = hemocoel, n = bacteriocyte nucleus. Figure S3. Laser-scanning confocal images of A. tsugae after FISH with the GS-A-specific probe GANA 1118r (labeled with A-568), indicating GS-A (Pseudomonas adelgestsugas; in red) are found only extracellularly in the hemocoel. A. Japanese sample from T. sieboldii (first instar) showing rod-shaped bacteria in the posterior body cavity. B. Western North America sample from T. heterophylla (second instar). C. Japanese sample from T. sieboldii egg showing bacteria free in the posterior cavity and clustered around developing bacteriome (arrows). D. Japanese sample from T. diversifolia egg, showing bacteria in the posterior region. Green = autofluorescence from insect tissue; b = bacteriome; h = hemocoel. Figure S4. Laser-scanning confocal images of A. tsugae after FISH with the GS-C-specific probe GamC440r (labeled with A-568), indicating GS-C (‘Ca. Annandia adelgestsuga’; in red) are harbored in bacteriocytes, are transmitted to eggs, and invade salivary glands in early instars. AC, samples from Japan. A. Sample from T. sieboldii, egg stage, showing ‘Ca. A. adelgestsuga’ clustered in two regions of one pole; not all bacteria appear to be contained within discrete bacteriocytes at this stage (arrow). B. Sample from T. diversifolia, first-instar stage showing ‘Ca. A. adelgestsuga’ in both bacteriome and salivary gland. C. Sample from T. diversifolia, firstinstar stage, showing ‘Ca. A. adelgestsuga’ in bacteriocytes. D-F, samples from North America. D. Sample from eastern North America, second-instar stage, showing ‘Ca. A. adelgestsuga’ in most areas of the bacteriome; some areas are unprobed (arrow). E. Sample from eastern North America, third-instar stage showing ‘Ca. A. adelgestsuga’ in most areas of the bacteriome; other areas are unprobed (arrows). F. Sample from western North America, first-instar stage, showing ‘Ca. A. adelgestsuga’ in both bacteriome and salivary gland (arrow). Green = autofluorescence from insect tissue; b= bacteriocyte/bacteriome, s = salivary gland. References Adolph, K.W. (ed) (1996) Microbial Genome Methods: CRC Press. Lane, D.J. (1991) 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematics. Stackebrandt, E., and Goodfellow, M. (eds). New York, NY: John Wiley and Sons, pp. 115-175. Munson, M.A., Baumann, P., Clark, M.A., Baumann, L., Moran, N.A., Voegtlin, D.J., and Campbell, B.C. (1991) Evidence for the establishment of aphid-eubacterium endosymbiosis in an ancestor of four aphid families. Journal of Bacteriology 173: 6321-6324. Spaulding, A.W., and von Dohlen, C.D. (1998) Phylogenetic characterization and molecular evolution of bacterial endosymbionts in psyllids (Hemiptera: Sternorrhyncha). Molecular Biology and Evolution 15: 1506-1513. Spaulding, A.W., and von Dohlen, C.D. (2001) Psyllid endosymbionts exhibit patterns of cospeciation with hosts and destabilizing substitutions in ribosomal RNA. Insect Molecular Biology 10: 57-67. Widjojoatmodjo, M.N., Fluit, A.C., and Verhoef, J. (1995) Molecular identification of bacteria by fluorescence-based PCR-single-strand conformation polymorphism analysis of the 16S rRNA gene. Journal of Clinical Microbiology 33: 2601-2606.