Phylogeography of the little black mussel around New Zealand: limits of
connectivity in a species with a long lived larval phase
Allan Wilson Centre Summer Studentship Report
Amarni Thomas
Supervisor: Jon Waters
Otago University
Introduction and Aims of this project
Molecular genetics and marine invertebrates
Mitochondrial DNA (mtDNA) is often used in phylogenetic analysis of a wide range of plant and animal
species, including Mytilidae (Apte & Gardner, 2002; Goldstien, Schiel, et al., 2006; Veale & Lavery, 2011;
Wood et al., 2007). Due to their maternal inheritance, mtDNA genes are typically not subject to
recombination, thus making the mitochondrial genome an appropriate marker for use in phylogenetic
analyses. Due to its relatively high rate of evolution, mtDNA is especially beneficial for determining
significant variation between species and the variance within species (Brown et al., 1982).
The most frequently used gene for measuring mtDNA variation is the mitochondrial cytochrome c oxidase
subunit I (COI) gene (Hebert, 2003). COI has been shown to be informative at two different levels of
species analysis: determining relationships among very closely related taxa, and resolution of associations
between different animal groups (Bucklin, 2011; Spencer et al., 2009). COI has revealed significant
population genetic structuring of many different marine species including bivalves (DeBoer, 2008; Feng et
al., 2011; Mikkelsen et al., 2007). Several studies have used COI to review larval dispersal, and conduct
population genetic and phylogenetic analyses of marine organisms (Cowen & Sponaugle, 2009; Hellberg,
2009).
In some species, mitochondria can be paternally inherited as well as maternally. This heteroplasmy has
been reported in the gonadal cells of mussels (Hoeh et al., 1991).
Phylogenetic structure of Xenostrobus pulex
Previously, cladistic analyses of the Xenostrobus genus have involved measurement of morphological,
anatomical and ecological characters (Wilson, 1967). Little is known about the genetic differentiation
between these species, let alone within a species.
Xenostrobus pulex were sampled as outgroup species in a 2007 study and the COI region of the
mitochondrial genome was amplified (Wood et al., 2007).
Mechanism of dispersal
Recent studies of marine invertebrates show significant evidence to support the theory that small
populations become established in widely separated places, by long distance dispersal events (Borsa &
Benzie, 1996; Donald et al., 2005; Thiel & Gutow, 2005). However, distribution of marine populations can
vary due to the environmental factors encountered during the larval dispersal phase. The role of ocean
currents in facilitating the dispersal of marine invertebrates with a free-living larval phase is often
incorporated in studies (Apte & Gardner, 2002; Chiswell, 2009; Gaylord & Gaines, 2000; Ross et al., 2009;
Wood et al., 2007).
Figure Error! No text of specified style in document.: General circulation and position of fronts in the South-west
Pacific Ocean. Taken from (Heath, 1985).
New Zealand is surrounded by many offshore currents (Figure1). In the North, the Tasman Front travels
from Australia, to pass around the northern tip of New Zealand (Stanton, 1981). The Tasman Front flows
along the east of the North Island, first as the East Auckland Current and then as the East Cape Current. On
the other side of New Zealand, the westerly winds travel across the Tasman Sea forcing warm water against
the South Island, forming the Westland Current and the Southland Current (Heath, 1985). Part of the
Westland Current moves through Cook Strait as the D’Urville Current. The Southland Current flows in a
north easterly direction around the bottom of New Zealand (Heath, 1973) (Heath, 1981). The Southland
Current covers the south of the South Island and then travels up the east coast towards Banks Peninsula
(Heath, 1973). Near Banks Peninsula most of the Southland Current meets the East Coast Current and they
merge at the Sub-tropical convergence, the resulting current is diverted east into the Pacific Ocean (Carter
& Heath, 1975). The rest of the Southland Current continues north to mix with water from Cook Strait
(Heath, 1985).
There is evidence of oceanic transport of some mussel larvae in ship ballast tanks (Ricciardi, 1998, 2000).
Commercial mussel species are also transported for aquaculture (Keeley, 2009 ). Xenostrobus securis is a
well known invader species, however there is no evidence of human translocation of X. pulex (Pascual et
al., 2010).
Previous studies have proposed putative dispersal barriers on both the West and East Coast just south of
Cook Strait. A north-south split in population structure of marine taxa has been observed in a large number
of wide-ranging studies (Apte & Gardner, 2002; Ayers & Waters, 2005; Goldstien, Gemmell, et al., 2006;
Ross et al., 2009; Veale & Lavery, 2011). Phylogeographic studies of several non-motile marine
invertebrates show varied patterns of genetic structure. These differing patterns seen in marine
invertebrates suggest that biogeography, oceanography and species-specific ecology could be influencing
the genetic structure.
Aims of research and hypotheses
This research project will focus on the use of the COI region of the mitochondrial genome to test for the
influence of ocean currents around New Zealand in shaping population genetic structure and
phylogeography. The aim of the investigation is to ascertain whether X. pulex is following dispersal trends
observed in other New Zealand marine invertebrate populations. I predict that the majority of the
population will exhibit a New Zealand wide haplotype, as seen in phylogenetic studies of New Zealand
marine invertebrates, there is also the possibility of a phylogeographic break between haplotypes.
Methods
Obtaining mitochondrial DNA sequence
Sites and sample collection of Xenostrobus pulex
Field collections of Xenostrobus pulex samples were taken from 19 localities from New Zealand (Figure 2).
All samples were collected by hand from mussel beds on intertidal rocks. The collections from each site
were labelled and stored in 95% ethanol in falcon tubes. All samples were washed in 95% ethanol before
storage at 4°C in the laboratory.
DNA extraction
The samples of mussels were removed from ethanol and placed on a paper towel to soak up excess
ethanol. A small (~1mm²) piece of tissue was taken from the mantle; this ensured there was no gonadal
tissue being sampled. I prepared the DNA extractions using the protocol established in Zavodna et al. 2008
(Zavodna et al., 2008). 200 µL of extraction buffer and 3 µL of Proteinase K (Roche, 20 mg/mL) were added
to each tube. Tubes were incubated at 55°C overnight. The solution was vortexed and then allowed to
cool. 70 µL of 10 M ammonium acetate was added before a brief vortexing, followed by centrifuging at
maximum speed for 10 minutes at room temperature. The supernatant (250 µL) was transferred to a new
tube, 500 µL of ice-cold 100% ethanol (Pure Science) was added to the supernatant and it was left on an ice
bed for 1 hour. Each tube was centrifuged at maximum speed for 30 minutes at 4°C. All liquid was
removed so that only a DNA pellet remained. The pellet was washed with 400 µL of 70% ethanol, and then
centrifuged at maximum speed for 5 minutes at room temperature. All liquid was then removed and the
pellet was air-dried at 60°C in an incubator. The DNA pellet was dissolved in 20 µL MilliQ water.
Figure Error! No text of specified style in document.: Collection Sites from New Zealand
PCR amplification of mitochondrial DNA
Table 1: PCR Reagents
Reagent
Amount per 20µL (reaction volume)
10 x reaction buffer (Bioline)
2 µL
8 mM dNTPs (Bioline)
2 µL
25 mM MgCl2 (Bioline)
1.5 µL
10 pmol HCO2198 (Sigma)
1 µL
10 pmol LCO1490 (Sigma)
1 µL
Taq DNA polymerase (Bioline)
0.15 µL
BSA (New England Biolabs)
0.4 µL
MilliQ Water
11.5 µL
Dissolved DNA
0.5 µL
A 658 base-pair (bp) region of the mitochondrial gene cytochrome c oxidase subunit I (COI) was amplified
with the forward primer LCO1490 5' GGTCAACAAATCATAAAGATATTGG 3' and reverse primer HCO2198 5'
TAAACTTCAGGGTGACCAAAAAATCA 3' (Folmer et al., 1994)
19.5 µL of the PCR mix (Table 1) was added to each well in PCR plates, with 0.5 µL of MilliQ- dissolved DNA
from extraction process. A drop of mineral oil was placed in each well, the PCR plate was then covered with
tinfoil for thermal cycling.
Amplification was performed in an Eppendorf PCR Mastercycler® as follows: 95°C for 2 minutes; 40 cycles
of 95°C for 50 seconds, 50°C for 50 seconds, 72°C for 1 minute, followed by an extension at 72°C for 10
minutes. 2 µL of PCR product for each sample was mixed with approximately 2 µL of loading dye and
loaded onto a 1% agarose (Bioline) gel, with 0.1 µL SYBR Safe (Invitrogen Co. USA) added before the gel set.
2 µL of 100bp/1kb DNA ladder (Global Science) was added to the last well of each gel to confirm size of PCR
products. The gels were visualised and photographed using a UVItec Gel Documentation System.
Purification and sequencing of PCR-products
DNA purification was performed using an Ultra-Sep® Gel Extraction Kit (Omega Bio-Tek), according to the
manufacturers’ instructions. The remaining 18 µL of PCR product was added with 32 µL of MilliQ water and
50 µL of binding buffer to an eppendorf tube. 5 µL of Ultra-Sep beads were added to each tube then
centrifuged at 10,000g for 1 minute. The resulting liquid was discarded and 300 µL of binding buffer was
added to each tube to resuspend the pellets by a brief vortexing. The tubes were then centrifuged at
10,000g for 1 minute, liquid discarded and 750 µL of wash buffer was added to the eppendorf, and the
pellet was then resuspended. The tubes were again centrifuged at 10,000g for 1 minute and all liquid was
discarded from the tube. The pellets were then dried in a 50°C hot block for a few minutes until they were
bright white. Finally the purified DNA was eluted; 15 µL of elution buffer was added to the tube, the pellet
was vortexed and then the tube was left to incubate at 50°C for 5 minutes. The tubes were centrifuged at
10,000g for 1 minute and the clear liquid was transferred to a clean eppendorf tube.
The DNA concentration of each sample was measured by spectrophotometry, using a Nanodrop® ND-1000
Spectrophotometer. 21 ng of the DNA was combined with 1 µL of 3.2 pmol primer LCO1490 in a total
volume of 5µl (MilliQ water added as needed), as required by the sequencing service. Purified DNA was
stored in clean collection tubes at 4°C.
Prepared samples were sent to Genetic Analysis Services (Department of Anatomy, University of Otago)
with the primer LCO1490 (Folmer et al., 1994), for sequencing using a capillary ABI 3730xl DNA Analyser.
Analyses of mitochondrial DNA sequence data
Alignment
Sequences were confirmed to be X. pulex by using Basic Local Alignment Search Tool (BLAST) and
comparing the sequences to the published GenBank X. pulex COI sequence (DQ917582.1) (Altschul et al.,
1990; Benson et al., 2000; Wood et al., 2007). The species identity of sequences dissimilar to DQ917582.1
was explored by additional BLAST searches. Sequences were preliminarily aligned using Sequencher 5.0
(Gene Codes Corporation). Ambiguous base calls were examined by eye and manually corrected if
necessary. Once the primer sequences were removed from both the 5’ and 3’ ends and the ends were
trimmed to ensure only good quality sequence remained, there was 621 bp within the COI region which
could be used for inclusion in phylogenetic analyses.
Four additional COI sequences were downloaded from GenBank: one from X. atrata (GQ480326.1) (Liu et
al. 2011 submitted), one from X. atratus (AB298599.1) (Kimura et al. 2007 submitted), one from X. securis
(JF430154.1) (Guerra et al. 2012 submitted) and one from Perna canaliculus (DQ917608.1) (Wood et al.,
2007). These COI sequences were included as outgroup taxa along with a COI sequence for Mytilus edulis
which was sequenced in this project (Table 2).
Bioedit 7.1.3.0 (Hall, 1999) was used to align all the sequences, to prepare them for exploratory analyses
and file conversions were made with MEGA 5.1 (Tamura et al., 2011).
Table 2: Species, location and GenBank Accession number for COI sequences included in phylogenetic analyses. (Note:
species indicated by asterisk (*) are from unpublished data)
Species
Location
GenBank
Xenostrobus pulex
New Zealand
DQ917582.1
Xenostrobus atrata
China
GQ480326.1
Xenostrobus atratus
Japan
AB298599.1
Xenostrobus securis
Spain
JF430154.1
Perna canaliculus
New Zealand
DQ917608.1
Mytilus edulis
New Zealand
*
Phylogenetic Analysis
MEGA 5.1 (Tamura et al., 2011) was used to build a neighbour joining tree for assessment of the COI
polymorphism among and species identity of the samples. Neighbour joining (NJ) methods can infer
evolutionary history of the sequences, as well as show the relationships between the taxa (Saitou & Nei,
1987). The sequences were analysed using p-distance; this method uses the proportion (p) of nucleotide
sites at which two sequences being compared are different to compute the tree branches. MEGA was also
used to calculate average sequence divergence among any major clades found in the NJ-analysis. In order
to assess the relationships between the closely related New Zealand haplotypes, a maximum parsimony
network was built using the software TCS 1.21 (Clement, 2000).
Results
Analyses of Mitochondrial DNA sequence data
Alignment of sequences and species identity of the samples
BLAST confirmed the sequences that were X. pulex and provided identification for samples that were
significantly different from DQ917582.1. Sequencing of purified products yielded 162 X. pulex sequences of
sufficient quality to include in phylogenetic analyses (Table 3). The primers HCO2198 and LCO1490
amplified the COI region, with good quality sequence 621 bp in length to be included in phylogenetic
analyses. These sequences were easily aligned by eye using Bioedit with each other and the outgroup taxa.
Three samples (CAT 1, PIC 7 and PIC 8) matched with the GenBank Mytilus edulis COI sequence
(JF825693.1) (Steinert et al., 2012) using BLAST. Because the GenBank Mytilus edulis COI sequence was only
399 bp, CAT 1 was included as the Mytilus edulis outgroup in the analyses.
Table Error! No text of specified style in document.: Collection localities, number, and sample codes of successfully
sequenced X. pulex individuals and haplotypes found at each locality.
Location
Number
Haplotypes Found
Ahipara
5
H-1
Orewa
9
H-1, H-2
Muriwai Beach
2
H-1, H-2
Mill Bay
3
H-1, H-22
Castle Point
12
H-1, H-8, H-10
Momorangi Bay
13
H-1, H-12, H-13, H-15, H-16, H-17
Collingwood
Beach
18
H-6, H-8, H-2,H-23, H-26, H-1
Milnthorpe Quay
14
H-12, H-19, H-24, H-26, H-27, H-2, H-1
Nelson
12
H-3, H-4, H-1, H-2,H-8
Port Motueka
13
H-2, H-1 ,H-20
White’s Bay
3
H-5, H-2, H-1
Picton Harbour
3
H-28, H-1
Coquille Bay
2
H-1
Goose Bay
8
H-8, H-11, H-19, H-1
Punakaiki
14
H-8, H-1
Okarito
7
H-8, H-1
North Island
South Island
Location
Number
Haplotypes Found
Peraki Bay
5
H-8, H-28, H-1
Puysegur Point
11
H-21, H-30, H-29, H-31, H-32, H-1, H-23
Cathedral Caves
8
H-7, H-9, H-8, H-1
Distance-based analyses using MEGA
Neighbour joining trees were built to look for multiple copies of the same haplotypes in the data, which
showed that many individuals carried identical haplotypes and illustrated how many different Xenostrobus
haplotypes were found (Figure 3). TCS analysed the variable sites and constructed a haplotype network
(Figure 4).
H-21
H-22
H-18
H-20
H-1
H-5
H-19
H-2
H-6
H-3
H-7
H-4
H-10
H-11
H-9
H-8
H-17
H-13
H-14
H-12
H-16
H-15
H-23
H-24
H-25
H-26
H-27
H-32
H-28
H-29
H-30
H-31
Xenostrobus atratus
Xenostrobus Securis
Xenostrobus atrata
Mytilus edulis
Perna canaliculus
0.1
Figure Error! No text of specified style in document.: Neighbour joining tree based on pairwise p-distances that
contains all the New Zealand Xenostrobus haplotypes and one Mytilus edulis sequence, along with a selection of
outgroup taxa from GenBank X. atrata (GQ480326.1) X. atratus (AB298599.1) X. securis (JF430154.1) Perna canaliculus
(DQ917608.1). The scale is 10% sequence divergence.
Xenostrobus pulex mtDNA COI diversity
Mitochondrial COI exhibited genetic polymorphism within New Zealand X. pulex, with 32 observed
haplotypes (Table 3). Among them, there were 36 variable sites detected in MEGA analyses.
The most common haplotype, H-1, had a New Zealand wide distribution, occurring at all sampled locations
(Figures 4). H-1 was found in 57% of X. pulex COI sequences, compared to the second most common
haplotype (H-8) which occurred in 12% of individuals. Several haplotypes appeared to be island-specific, H10 and H-22 were only found in the North Island; whereas the H12-17 and H23-32 were found only in the
South Island. The most diverged haplotypes (H-28-32) have at least 9bp mutations different than the most
common haplotype.
Figure 1: Haplotype network diagram for the New Zealand clades of X. pulex for mtDNA (COI) datasets. Each circle
represents a different sequence. Circle size is scaled according to haplotype frequency. A black line between circles
corresponds to one bp substitution. Black dashes represent hypothetical intermediate haplotypes not detected.
Discussion
Phylogeographic structure of New Zealand Xenostrobus pulex
The phylogenetic analysis of New Zealand Xenostrobus pulex revealed significant population genetic
structuring. The most prominent haplotype was H-1, which had a New Zealand wide distribution (Figure 4).
Many studies of New Zealand marine invertebrates have observed disjunction between northern and
southern populations (Apte & Gardner, 2002; Goldstien, Gemmell, et al., 2006; Star, 2003; Veale & Lavery,
2011; Waters, 2004; Waters et al., 2005). This study highlights north-south differentiation of X. pulex with
the strong south Island divergence of H-28-32. The location of north-south differentiation is often reported
to occur around 42°S, near Cape Campbell (Figure 4.2). The observed distribution of the H-28-32
haplotypes supports a break in X. pulex at this location. One haplotype sample was found in Picton, which is
above the previously described north-south split (Figure 5). As exceptions to the Cape Campbell break are
extremely rare, more sampling is required to show the full distribution of this divergent clade.
In New Zealand weather patterns are highly variable and have wind-driven features such as upwelling
(Heath, 1973). Upwelling has often been proposed as a barrier to larval dispersal. Consequently this
upwelling is responsible for observed north-south disjunction (Apte & Gardner, 2002);(Star, 2003) (Ayers &
Waters, 2005; Waters, 2004). It has been hypothesised that upwelling on the northern east and west coasts
of the South Island could cause breaks in species with short lived larval phases, as larvae passing into these
regions die before they get out of the upwelling circulation (Ross et al., 2009). However this mechanism
alone is unlikely to be responsible for the genetic divergences observed across this region. Detailed studies
in this area of oceanography, phylogeography and larval behaviour are necessary to adequately test this
hypothesis. The New Zealand wide (H-1) haplotype could have arisen due to transport of larvae from
northern to southern populations via the East Cape Current (ECC) as the flow from the north could provide
gene flow around New Zealand. The ECC flows down the east coast of the North Island to approximately
42°S, which is the same latitude as the upwelling at the top of the South Island (Figure 1)
There is probably no larval dispersal from the South Island to the North Island as there is no current that
flows in that direction (Figure 1). This could account for the formation of the distinct haplogroup H28-32
and its confinement to the South Island.
Figure 5: The Cook Strait region (New Zealand) with major currents showing proposed the north-south
phylogeographic split at 42°S, which is evident among other populations of several species of marine invertebrates.
Dotted lines south of Cook Strait indicate the location of upwelling zones implicated in preventing larval transport
between northern and southern populations. Data summarized from (Apte & Gardner, 2002; Goldstien, Schiel, et al.,
2006; Star, 2003; Veale & Lavery, 2011; Waters, 2004; Waters et al., 2005)(Adapted from (Veale & Lavery, 2011)and
(Ross et al., 2009)).
As there are limited North Island specimens and collection localities, inference of the distribution of
haplotypes throughout New Zealand is therefore preliminary. While no firm conclusions can be drawn from
the small number of samples, there is some support for the north-south pattern that has been previously
described in other species.
Directions for future research
Further sampling of New Zealand X. pulex from more sites would further refine the understanding of the
phylogeographical structure of this species. Additional samples should be collected from the West and East
Coasts of the North Island to provide stronger evidence of north-south differentiation. This information is
required to better recognise the factors which prevent gene flow between regional populations. AMOVA
tests need to be done to determine if the north-south differentiation is statistically significant.
Although the current study supports previously published phylogeographic disjunction, it does not provide
information as to how this disjunction was initially formed and is currently maintained. Examination of the
hydrology of this area may help determine what factors are affecting population connectivity.
Overall Conclusions
Phylogeographic disjunctions were observed for populations of the intertidal Xenostrobus pulex around
New Zealand. Disjunction separating the North and South Island populations was detected and this
difference appears to be a general feature of many marine invertebrates. This study highlights the
significance and ubiquity of the common north-south phylogeographical disjunction. As this area is one of
complex hydrography, further research is needed to help determine the cause.
References
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool.
Journal of Molecular Biology, 215(3), 403-410. doi: 10.1016/s0022-2836(05)80360-2
Apte, S., & Gardner, J. P. A. (2002). Population genetic subdivision in the New Zealand greenshell mussel
(Perna canaliculus) inferred from single-strand conformation polymorphism analysis of
mitochondrial DNA. Molecular Ecology, 11(9), 1617-1628.
Ayers, K. L., & Waters, J. M. (2005). Marine biogeographic disjunction in central New Zealand. Marine
Biology, 147(4), 1045-1052. doi: 10.1007/s00227-005-1632-7
Benson, D. A., Karsch-Mizrachi, I., Lipman, D. J., Ostell, J., Rapp, B. A., & Wheeler, D. L. (2000). GenBank.
Nucleic Acids Research, 28(1), 15-18. doi: 10.1093/nar/28.1.15
Borsa, P., & Benzie, J. A. H. (1996). Population genetics of Trochus niloticus and Tectus coerulescens,
topshells with short-lived larvae. Marine Biology, 125(3), 531-541. doi: 10.1007/bf00353266
Brown, W. M., Prager, E. M., Wang, A., & Wilson, A. C. (1982). Mitochondrial DNA sequences of primates:
tempo and mode of evolution. Journal of molecular evolution, 18(4), 225-239.
Bucklin, A. (2011). DNA Barcoding of Marine Metazoa. Annual Review of Marine Science, 3(1), 471-508. doi:
10.1146/annurev-marine-120308-080950
Carter, L., & Heath, R. A. (1975). Role of mean circulation, tides, and waves in the transport of bottom
sediment on the New Zealand continental shelf. New Zealand Journal of Marine and Freshwater
Research, 9(4), 423-448. doi: 10.1080/00288330.1975.9515579
Chiswell, S. M. (2009). Colonisation and connectivity by intertidal limpets among New Zealand, Chatham
and Sub-Antarctic Islands. II. Oceanographic connections. Marine Ecology-Progress Series, 388, 121135. doi: Doi 10.3354/Meps08167
Clement, M. (2000). TCS: a computer program to estimate gene genealogies. Molecular Ecology, 9(10),
1657-1659. doi: 10.1046/j.1365-294x.2000.01020.x
Cowen, R. K., & Sponaugle, S. (2009). Larval Dispersal and Marine Population Connectivity. Annual Review
of Marine Science, 1(1), 443-466. doi: doi:10.1146/annurev.marine.010908.163757
DeBoer, T. S. (2008). Phylogeography and Limited Genetic Connectivity in the Endangered Boring Giant
Clam across the Coral Triangle. Conservation biology, 22(5), 1255-1266. doi: 10.1111/j.15231739.2008.00983.x
Donald, K., Kennedy, M., & Spencer, H. (2005). Cladogenesis as the result of long-distance rafting events in
South Pacific topshells (Gastropoda, Trochidae). Evolution; International Journal of Organic
Evolution, 59(8), 1701-1711.
Feng, Y., Li, Q., Kong, L., & Zheng, X. (2011). DNA barcoding and phylogenetic analysis of Pectinidae
(Mollusca: Bivalvia) based on mitochondrial COI and 16S rRNA genes. Molecular Biology Reports,
38(1), 291-299. doi: 10.1007/s11033-010-0107-1
Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers for amplification of
mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol
Biotechnol, 3(5), 294-299.
Gaylord, B., & Gaines, S. D. (2000). Temperature or transport? Range limits in marine species mediated
solely by flow. American Naturalist, 155(6), 769-789.
Goldstien, S. J., Gemmell, N. J., & Schiel, D. R. (2006). Molecular phylogenetics and biogeography of the
nacellid limpets of New Zealand (Mollusca : Patellogastropoda). Molecular Phylogenetics and
Evolution, 38(1), 261-265. doi: DOI 10.1016/j.ympev.2005.09.002
Goldstien, S. J., Schiel, D. R., & Gemmell, N. J. (2006). Comparative phylogeography of coastal limpets
across a marine disjunction in New Zealand. Molecular Ecology, 15(11), 3259-3268. doi: DOI
10.1111/j.1365-294X.2006.02977.x
Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for
Windows 95/98/NT. Nucleic acids symposium series (1979), 41, 95.
Heath, R. A. (1973). Direct measurements of coastal currents around southern New Zealand. New Zealand
Journal of Marine and Freshwater Research, 7(4), 331-367. doi: 10.1080/00288330.1973.9515480
Heath, R. A. (1981). Oceanic fronts around southern New Zealand. Deep Sea Research Part A.
Oceanographic Research Papers, 28(6), 547-560. doi: 10.1016/0198-0149(81)90116-3
Heath, R. A. (1985). A review of the physical oceanography of the seas around New Zealand — 1982. New
Zealand Journal of Marine and Freshwater Research, 19(1), 79-124. doi:
10.1080/00288330.1985.9516077
Hebert, P. D. N. (2003). Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely
related species. Proceedings of the Royal Society of London Series B — Biological Sciences, 270, S96S99.
Hellberg, M. E. (2009). Gene Flow and Isolation among Populations of Marine Animals. Annual Review of
Ecology, Evolution, and Systematics, 40(1), 291-310. doi:
doi:10.1146/annurev.ecolsys.110308.120223
Hoeh, W., Blakley, K., & Brown, W. (1991). Heteroplasmy suggests limited biparental inheritance of Mytilus
mitochondrial DNA. Science, 251(5000), 1488-1490. doi: 10.1126/science.1672472
Keeley, N. F., B; Hopkins, G; Gillespie, P; Clement, D; Webb, S; Knight, B; Gardner, J. (2009 ). Sustainable
aquaculture in New Zealand: Review of the ecological effects of farming shellfish and other non-fish
species. Prepared for the Ministry of Fisheries.
Mikkelsen, N. T., Schander, C., & Willassen, E. (2007). Local scale DNA barcoding of bivalves (Mollusca): a
case study. Zoologica Scripta, 36(5), 455-463. doi: 10.1111/j.1463-6409.2006.00289.x
Pascual, S., Villalba, A., Abollo, E., Garci, M., González, A., Nombela, M., . . . Guerra, A. (2010). The mussel
Xenostrobus securis : a well-established alien invader in the Ria de Vigo (Spain, NE Atlantic).
Biological Invasions, 12(7), 2091-2103. doi: 10.1007/s10530-009-9611-4
Ricciardi, A. (1998). Global range expansion of the Asian mussel (Mytilidae): Another fouling threat to
freshwater systems. Biofouling (Chur, Switzerland), 13(2), 97-106. doi:
10.1080/08927019809378374
Ricciardi, A. (2000). Recent mass invasion of the North American Great Lakes by Ponto–Caspian species.
Trends in ecology & evolution (Amsterdam), 15(2), 62-65. doi: 10.1016/s0169-5347(99)01745-0
Ross, P. M., Hogg, I. D., Pilditch, C. A., & Lundquist, C. J. (2009). Phylogeography of New Zealand's coastal
benthos. New Zealand Journal of Marine and Freshwater Research, 43(5), 1009-1027. doi:
10.1080/00288330.2009.9626525
Saitou, N., & Nei, M. (1987). The neighbor-joining method: a new method for reconstructing phylogenetic
trees. Molecular Biology and Evolution, 4(4), 406-425.
Spencer, H. G., Marshall, B. A., & Waters, J. M. (2009). Systematics and phylogeny of a new cryptic species
of Diloma Philippi (Mollusca: Gastropoda: Trochidae) from a novel habitat, the bull kelp holdfast
communities of southern New Zealand. Invertebrate Systematics, 23(1), 19-25. doi:
http://dx.doi.org/10.1071/IS08030
Stanton, B. R. (1981). An oceanographic survey of the Tasman Front. New Zealand Journal of Marine and
Freshwater Research, 15(3), 289-297. doi: 10.1080/00288330.1981.9515924
Star, B. (2003). Genetic structuring among populations of the greenshell mussel Perna canaliculus revealed
by analysis of randomly amplified polymorphic DNA. Marine ecology. Progress series (Halstenbek),
249, 171.
Steinert, G., Huelsken, T., Gerlach, G., & Bininda-Emonds, O. P. (2012). Species status and population
structure of mussels (Mollusca: Bivalvia: Mytilus spp.) in the Wadden Sea of Lower Saxony
(Germany). Organisms Diversity & Evolution, 1-16. doi: 10.1007/s13127-012-0075-5
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., & Kumar, S. (2011). MEGA5: Molecular
Evolutionary Genetics Analysis Using Maximum Likelihood, Evolutionary Distance, and Maximum
Parsimony Methods. Molecular Biology and Evolution, 28(10), 2731-2739. doi:
10.1093/molbev/msr121
Thiel, M., & Gutow, L. (2005). The ecology of rafting in the marine environment. II. The rafting organisms
and community. Oceanography and Marine Biology - an Annual Review, Vol. 43, 43, 279-418.
Veale, A. J., & Lavery, S. D. (2011). Phylogeography of the snakeskin chiton Sypharochiton pelliserpentis
(Mollusca: Polyplacophora) around New Zealand: are seasonal near-shore upwelling events a
dynamic barrier to gene flow? Biological Journal of the Linnean Society, 104(3), 552-563. doi: DOI
10.1111/j.1095-8312.2011.01743.x
Waters, J. M. (2004). Phylogeography of a high-dispersal New Zealand sea-star: does upwelling block geneflow? Molecular Ecology, 13(9), 2797-2806. doi: 10.1111/j.1365-294X.2004.02282.x
Waters, J. M., King, T. M., O'Loughlin, P. M., & Spencer, H. G. (2005). Phylogeographical disjunction in
abundant high-dispersal littoral gastropods. Molecular Ecology, 14(9), 2789-2802. doi:
10.1111/j.1365-294X.2005.02635.x
Wilson, B. R. (1967). A new generic name for three recent and one fossil species of Mytilidae (Mollusca:
Bivalvia) in southern Australasia, with redescription of the species. [Article]. Proceedings of the
Malacological Society of London, 37, 279-295.
Wood, A. R., Apte, S., MacAvoy, E. S., & Gardner, J. P. A. (2007). A molecular phylogeny of the marine
mussel genus Perna (Bivalvia: Mytilidae) based on nuclear (ITS1&2) and mitochondrial (COI)
DNA sequences. Molecular Phylogenetics and Evolution, 44(2), 685-698. doi:
10.1016/j.ympev.2006.12.019
Zavodna, M., Sandland, G. J., & Minchella, D. J. (2008). Effects of intermediate host genetic background on
parasite transmission dynamics: A case study using Schistosoma mansoni. Experimental
Parasitology, 120(1), 57-61. doi: 10.1016/j.exppara.2008.04.021