mec13372-sup-0001-TableS1

advertisement
S1. Characteristics of 13 microsatellite primers used in this study, developed by Wang et al. 2009. All primers annealed at 49°C
Locus
Primer sequence (5'-3')
Reference repeat motif
Fluorescent label
No. alleles
Product size (bp)
EST_016
CTATCTGTGTATGATCAGGACTA
(AAC)7
FAM
2
97-111
(TAA)21
FAM
3
119-125
(TC)8
VIC
6
97-114
(TGA)7
PET
4
127-136
(TG)12
VIC
2
96-129
(GAT)9
PET
2
117-123
(ATG)10
VIC
6
152-170
(TAA)9
VIC
19
131-179
(CA)10
FAM
5
116-123
(CA)12
PET
2
92-94
(AAT)9
VIC
12
164-197
(AATC)7
VIC
2
103-110
(TAA)8
PET
3
181-191
TCCATCTGTTGTGGAAACTGGT
EST_032
AGGCACAAGAAAGTGGAAAACAA
TGAAGGGATGTGAAGCATGGT
EST_063
TATTGTAGTCGTTACGTAGGCT
AACAATCGTGCATACTAGCTCA
EST_097
TGACAACGACATCAATCATGGT
ACAGCAGGAGCTGTCAGCACT
EST_098
ACAAATTGCGCTCAAGTTGATG
ACGGCTGCGAAGGAGTCTAGT
EST_149
ACGTCAAATGGATTTTCACATGA
AGGTGCTTCTCTTTCCTCAGA
EST_181
TGATTGCTGAGAAAGCTAGAGAT
GCCTCACCTTGCCTTGTACA
EST_196
GTGTTGGCTATCTCATGTATAGT
ACAACACATCATCAACAACAGCA
EST_245
CAGAATGATATTTCTGCAGCACT
CGCAATCGAGATTATAGGAAGA
EST_254
GGTGACCAATCAGAGTCTTGA
TACACTTGCTATAGTAACTTGCT
WGS_112
ACTCCACTCAGTCCTATTACCA
ACACTTCCAAGAGTCCCTACA
WGS_153
TTTCCAAGTTGCTGTGAGTACA
CGGGTGCTAAGCTTGCTCAA
WGS_211
TGACGACGAAACGTTGGCTAT
AGACCGTTTCCTTTAACCAGAA
Download
Random flashcards
Arab people

15 Cards

Radiobiology

39 Cards

Pastoralists

20 Cards

Radioactivity

30 Cards

Create flashcards