Table S1. Sequences of primers designed for analyses of cpDNA sequence variation in Phleum pratense Name of primer rps16 psbM petN trnQ-UUG trnD-GUC psbM petN trnC-GCA psbH petB rpl16 rps3 petB petD trnCF nested rpoB nested rbcL nested Primer sequence gcacgttgctttctaccaca cattttggctggctgttttt cagcccaagcgagacttact atcccgttactcggaggttc ctgtcaaggcggaagctg cattttggctggctgttttt cagcccaagcgagacttact caggggactgcaaatcctt tcttctgttttactggacggaat tgcaattgcctgaatctcaa tgaaatgagaaagcgtgcaa cttcgcattctgtccagtga gtacctgacgccattccagt ggctcgagcaagaatgaaag cgagcgaaaatcgagaaaag ccaggggtacaaatggaatg gcggcttgtgaagtatggaa Table S2. Summary of the output of the 11 SSR loci scored for variation in 19 populations of Phleum pratense SSR marker A03A07 C02C08 C01B11 C02H01 A09H08 D01G10 A03E06 D01H08 A10A10 B03A09 D01E04 Total no. of Range of alleles alleles per individual 51 25 31 53 15 75 51 20 41 44 56 1-5 1-6 1-6 1-6 2-5 1-6 1-6 1-5 1-6 1-5 1-6 Average no. of alleles per individual 2.07 2.68 3.97 2.98 3.59 2.32 2.47 1.93 2.77 2.51 2.87 Table S3. Genetic diversity based on SSR marker analyses in 19 populations of Phleum pratense. Accession number, country of origin and number of individuals, loci analysed and polymorphic loci is given. The diversity indices calculated were mean number of pairwise differences between individuals and average gene diversity over loci. Standard deviations are given. Pop. no Accession number Country of origin No No of of inds. loci 11 10 12 15 14 8 19 40 46 44 45 38 39 16 27 34 25 1 3 NGB4053 NGB1332 NGB4140 NGB17198 NGB14403 NGB722 KEW51998 IHAR150183 IHAR150844 IHAR151366 GR4123 PL381926 PL406317 IHAR151908 PL210426 PL325461 PL204480 14G2400116 RCAT040682 Denmark Sweden Iceland Norway Finland Sweden England Spain Italy Switzerland Switzerland France Russia Germany Greece Russia Turkey Czech Republic Hungary 12 12 14 15 17 18 18 18 10 16 14 12 13 10 13 16 17 18 12 457 461 461 461 459 461 461 461 461 461 461 461 461 459 461 457 461 459 461 No of pol loci 110 147 165 155 167 102 130 144 77 105 61 102 127 111 118 142 139 164 122 Average differences Average gene diversity 37.1 ± 17.38 43.7 ± 20.44 44.9 ± 20.72 41.6 ± 19.13 42.0 ± 19.17 30.3 ± 13.9 36.6 ± 16.71 38.8 ± 17.71 26.3 ± 12.6 31.0 ± 14.29 18.6 ± 8.79 36.1 ± 16.91 39.9 ± 18.57 37.0 ± 17.61 38.4 ± 18.85 39.0 ± 17.88 37.5 ± 17.15 41.1 ± 18.73 40.1 ± 18.77 0.08 ± 0.043 0.09 ± 0.050 0.10 ± 0.050 0.09 ± 0.047 0.09 ± 0.047 0.07 ± 0.034 0.08 ± 0.041 0.08 ± 0.043 0.06 ± 0.031 0.07 ± 0.035 0.04 ± 0.021 0.08 ± 0.041 0.09 ± 0.045 0.08 ± 0.043 0.08 ± 0.044 0.09 ± 0.044 0.08 ± 0.042 0.09 ± 0.046 0.09 ± 0.046