Cai et al. – Online Tables
Online Table 1: PCR primers used to generate DNA templates for the synthesis of probes for in situ
hybridization. For each gene, forward and reverse PCR primers are given, together with the predicted
size of the band generated from PCR with mouse genomic DNA. All reverse primers contain a T7
polymerase sequence at their 5’ end (GGATCCTAATACGACTCACTATAGGGAG)
Online Table 2: PCR primers used to amplify candidate Atoh1 target sequences from DNA
fragments of chromatin immunoprecipitation from Atoh1-GFP fusion mice.
Online Table 3: List of 614 significantly enriched genes obtained from RNA-seq of purified Atoh1GFP cells. All genes with an adjusted P value of 10-30 or lower are shown, together with their
expression level in RPKM and fold change compared to GFP- cells. If a gene contains a candidate
Atoh1 binding site with 5kb of its transcriptional start site, the motif and its position relative to the start
site are indicated in column G. The second table shows a reduced list of 302 genes from this set that
had an RPKM>3000.
Online Table 4: List of 233 genes enriched in Atoh1-GFP+ cells that are candidate Atoh1 target
genes. Criteria for inclusion in this list are either the presence of an Atoh1-binding site (AtEAM (Klisch
et al., 2011)) within 5kb of the transcriptional start site, or the presence of the locus in Atoh1 ChIP-seq
experiments from the cerebellum (Klisch et al., 2011) and/or intestine (Kim et al., 2014).
Online Table 5: Comparison of expression of 614 transcripts significantly enriched in Atoh1-GFP+
cells (see Online Table 3) with other recently published data sets. The first three columns are data
from microarray analysis of individually isolated mature inner and outer hair cells (Liu et al., 2014).
The first column lists genes significantly enriched in outer hair cells that also occur in our P1 hair cell
gene list. The second column is a similar comparison for genes significantly enriched in inner hair
cells. The third column compares our P1 hair cell gene list to the top 200 genes in either outer or
inner hair cells.
Column E refers to a recently published analysis of transcriptional changes in the regenerating
chicken utricle (Ku et al., 2014). In this study, 527 transcripts were identified as being candidate hair
cell genes based on the similar behavior of these transcripts during utricle regeneration compared to
known hair cell genes. We have compared our P1 hair cell gene list to these 527 genes and find 74
genes in common.
Online Table 6: List of transcripts enriched in our P1 Atoh1-GFP+ cells that are produced by known
deafness genes.
Kim TH, Li F, Ferreiro-Neira I, Ho LL, Luyten A, Nalapareddy K, Long H, Verzi M, Shivdasani RA
(2014) Broadly permissive intestinal chromatin underlies lateral inhibition and cell plasticity.
Nature 506:511-515.
Klisch TJ, Xi Y, Flora A, Wang L, Li W, Zoghbi HY (2011) In vivo Atoh1 targetome reveals how a
proneural transcription factor regulates cerebellar development. Proc Natl Acad Sci U S A
108:3288-3293.
Ku YC, Renaud NA, Veile RA, Helms C, Voelker CC, Warchol ME, Lovett M (2014) The
transcriptome of utricle hair cell regeneration in the avian inner ear. J Neurosci 34:3523-3535.
Liu H, Pecka JL, Zhang Q, Soukup GA, Beisel KW, He DZ (2014) Characterization of transcriptomes
of cochlear inner and outer hair cells. J Neurosci 34:11085-11095.