UCSC Genome Browser
Accessing the browser and tools:
1. Genome Wiki
 http://genomewiki.ucsc.edu/index.php/Main_Page
2. Genomes:
 Gateway Page: Genomes on the left blue bar and Genome Browser on top.
 Photo Gateway: Photographs of each species whose genome is available in the UCSC
genome browser
3. Genome Browser Interface
 Click on the hyperlink on the track name under track groups for track description.
 Right Click and View image to get image for publications.
 View-> Configure Browser
4. Searching the database:
1. Searching genes:
 PPP1R1B
2. Searching coordinates:
 chr21:33,031,597-33,041,570
3. Cytogenetic location
 17q12
5. Specific Tracks
1. Genetic Association Database (GAD) view
a. Example BRCA1, GAD
b. Mouse over red box to see the list of associated diseases
2. Gene and Gene Prediction Tracks
a. UCSC genes
b. TransMap Cross_species Alignments
c. Refseq
d. mRNA and EST Tracks
e. Conservation and Regulation Data
f. And many more.
6. Blat: On top blue bar: Tools -> Blat)
a. Fast alignment tool
b. BLAT on DNA is designed to quickly find sequences of 95% and greater similarity of
length 25 bases or more.
c. BLAT on proteins finds sequences of 80% and greater similarity of length 20 amino acids
or more.
d. Allows user to align DNA/protein to the genome assemblies.
e. Example: Align ‘PORIN_HUMAN’ from GCBA815 dataset page.
7. Tables: On the top blue bar and table browser on the left blue bar.
a. Retrieve data associated with tracks
b. Example: Mammal/Human/hg19/Genes and Gene Prediction Tracks/Refseq
Genes/refGene/genome
8. Gene Sorter : Allows to Explore gene families and relationships among genes. It displays a list of
genes that are related to each other in the selected genome.
a. Filter: human/hg19/ FOXA2/Expression(GNF Atlas 2)/configure(columns to display)
b. Description page:
i. http://genome.ucsc.edu/goldenPath/help/hgNearHelp.html
9. Genome Graphs:
a. Upload data set (genome-graph-example.txt)
i. Use hg18 as reference genome.
b. Description:
i. http://genome.ucsc.edu/goldenPath/help/hgGenomeHelp.html
10. PCR: Search for PCR primer sequence in a genome assembly.
a. Human/hg19/genome assembly/ TAACAGATTGATGATGCATGAAATGGG/
CCCATGAGTGGCTCCTAAAGCAGCTGC
11. VisiGene: a virtual microscope for viewing in situ hybridization images.
a. NM_007492
12. Utilities : tools to remove non-sequence-related characters from DNA or protein, to create a gif
image for a phylogenetic tree, and to convert genome coordinates between assemblies
a. http://genome.ucsc.edu/util.html
13. Downloads: Dumps of UCSC genome browser databases and open source tools.
14. Custom Tracks: Displaying your own annotations in the genome browser.
a. Session:
i. Creating account
ii. Resetting session from My Data -> Session -> Session management -> Click here
to reset
b. Example:
i. Upload test file “custom-track-example”
ii. URL example from golgi: http://genome.unmc.edu/ucsc/gcba_815/customtrack-example.bed
c. Description: http://genome.ucsc.edu/goldenPath/help/customTrack.html
Other Resources:
https://genome.ucsc.edu/training.html
Reference:
Harte, R. A., Diekhans, M., Kent, W. J. & Haussler, D. Guide to the UCSC Genome Browser. Cambridge,
MA: NPG Education, 2010
Galaxy (https://usegalaxy.org/)
Account Creation:
1. User -> Register
a. Required for saving history and accessing data in the future.
Input data:
1. Upload File from local computer
a. Download data from UCSC genome browser
i. Table Browser -> Mammal/Human/hg19/Genes and Gene Prediction
Tracks/UCSC Genes/knownGene/position:chr22/…./(output format) BEDbrowser extensible data/(output file)Exons/plain text/get output
2. UCSC Main
a. UCSC Main -> Mammal/Human/hg19/Variation/All
SNPs(138)/snp138/(position)chr22/…./(output format) BED-browser extensible
data/Galaxy checked/plain text/get output
b. Next Page -> Whole Gene/Send query to Galaxy
3. Other sources
Simple Data Manipulation
1. Finding Exons with highest number of SNPs
a. Operate on Genomic Intervals -> Join
i. Joins 1:Exons with 2:SNPs with min overlap 1
ii. Return: Only records that are joined(INNER) JOIN)
iii. Execute
b. Output:
chr2
2
16258185 16258303 uc002zlh.1_cds_1_0_chr22_16258186_r 0 - chr22 16258278 16258279 rs2845178
chr2
2
16258185 16258303 uc002zlh.1_cds_1_0_chr22_16258186_r 0 - chr22 16258285 16258286 rs113311305 0 +
chr2
2
16258185 16258303 uc002zlh.1_cds_1_0_chr22_16258186_r 0 - chr22 16258284 16258285 rs199586979 0 +
chr2
2
16258185 16258303 uc002zlh.1_cds_1_0_chr22_16258186_r 0 - chr22 16258293 16258294 rs200891952 0 +
chr2
2
16266928 16267095 uc002zlh.1_cds_2_0_chr22_16266929_r 0 - chr22 16266963 16266964 rs10154680
chr2
2
16266928 16267095 uc002zlh.1_cds_2_0_chr22_16266929_r 0 - chr22 16266984 16266985 rs376011635 0 +
c. Group the exons to count SNPs
i. Join, Subtract, and Group -> Group
1. Select Data ->Join on data 2 and data 1
2. Group by column 4
0 +
0 +
2.
3.
4.
5.
3. Operation =>Insert operation => Type -> count; On Column: 4
4. Exit
Sorting exons by SNP count
a. Filter and Sort -> Sort
Selecting top hits
a. Text Manipulation -> Select First
Recovering exon info and displaying data in genome browser
a. Join, Subtract and Group -> Compare two Datasets
i. 1:Exons/c4/7:Select first on data 6/c1/Matching rows of 1st dataset
Visualizing selected exons in genome browser
a. display at UCSC main
6. Histories
a. History of data, analysis and results.
7. Workflows
a. Pipeline that can be used to re run the analysis with minimal clicking
b. History Settings -> Extract Workflow -> give name -> Create Workflow
c. Select Workflow from top menu bar.
8. Other tools.
Reference
http://galaxyproject.org/