Carroll et al: Paternity assignment & demographic closure in right whales: Supplementary Material Supplementary Table 1: Three microsatellite loci used to augment the microsatellite genotype of southern right whales. Primer sequences and repeat units identified from the reference indicated. T A is the annealing temperature; mM Mg is the concentration of magnesium used in the reactions. Each 10 μL PCR reaction contained 1xPCR buffer, MgCl2 at concentration specified below, 0.4 μM each primer, 0.2 mM dNTPs, 0.25 units thermostable Platinum Taq DNA polymerase (Invitrogen) and 10-20 ng DNA template. The PCR reactions have cycling conditions of (i) an initial denaturing step at 94° C for 3 min; (ii) 30 cycles at 94° C for 30 sec, T A for 30 sec and 72° C for 30 sec; and (iii) a final extension step at 72° C for 10 min. Locus GT23 Primers F: GTTCCCAGGCTCTGCACTCTG Label TA (ºC) mM Mg Repeat Unit Reference VIC 58 2.0 (GT)n Bérubé, Jørgensen et al.(2000) NED 53 2.5 (TG)n Waldick, Brown et al. (1999) FAM 60 2.0 (GATA)n Frasier, Rastogi et al. (2006) R:CATTTCCTACCCACCTGTCAT RW34 F: CACTCAAGCCCCATAACG R: TAGTAGAGCCGTGATAAAGTGC TR3G10 F: GCTCCGCAACAAGAGAGG R: GCACATGACGCTCAGTGC Carroll et al: Paternity assignment & demographic closure in right whales: Supplementary Material Supplementary Table 2: DNA profiles of parent-offspring tryads: mtDNA control region haplotype (500 bp; mtDNA), genetically identified sex and microsatellite genotype. Dashed lines indicate the sample was not successfully genotyped at that locus. MM indicates a locus at which the assigned father offspring pair mismatched. Sample Eau03NZ03 Eau03NZ02 Eau97AI071 Eau05NZ03 Eau05NZ02 Eau06AI135 Eau06AI037 Eau06AI038 Eau06AI059 Eau07AI087 Eau07AI088 Eau95AI033 Eau07AI179 Eau07AI180 Eau98AI069 Eau07AI190 Eau07AI191 Eau07AI158 Eau07AI196 Eau07AI026 Eau98AI088 Eau08AI081 Eau08AI082 Eau08AI061 Eau08AI181 Eau08AI151 Eau07AI159 Eau09AI159 Eau09AI238 Eau06AI111 Status calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father Sex M F M F F M M F M M F M F F M F F M F F M F F M F F M M F M mtDNA B' B' A A A A D D A B+ A A A A B' B' B+ D D B+ A A C A A B+ B+ B+ D MM GATA28 TR3G2 GATA28 RW31 EV14 EV1 124/126 124/126 126/140 122/122 122/136 122/148 122/140 122/140 122/126 126/126 126/126 124/126 132/144 138/144 126/132 122/140 122/126 124/140 122/124 122/122 124/140 126/134 126/132 130/134 126/128 128/136 126/126 130/140 122/140 -/- EV14 122/135 133/135 122/129 133/133 120/133 133/135 129/141 129/141 133/141 133/135 133/133 133/135 131/133 133/139 131/137 133/135 135/141 120/133 135/141 135/141 122/135 137/141 133/137 137/141 133/137 133/137 133/133 122/122 120/122 133/133 EV37 189/199 199/203 189/189 203/205 187/203 197/205 203/203 197/203 189/203 191/199 191/201 199/207 201/203 201/203 193/203 189/199 199/203 189/189 189/203 201/203 189/201 207/207 207/207 189/207 195/207 197/207 195/203 197/205 201/205 197/203 GATA28 166/180 166/166 166/180 166/174 166/174 168/178 166/178 166/178 166/178 166/166 166/178 166/174 166/174 162/174 166/166 170/178 170/174 166/180 170/174 170/178 174/178 166/166 162/166 166/178 162/166 166/178 162/166 162/178 178/178 162/178 GATA98 116/116 108/116 104/116 112/124 104/124 112/116 116/120 112/120 116/116 112/116 112/112 116/116 108/112 108/112 104/112 116/120 116/116 112/120 104/112 112/112 104/116 112/116 104/112 112/116 108/116 108/116 116/116 108/112 112/120 108/112 GT23 114/116 -/114/116 116/116 116/118 114/116 108/108 108/110 108/110 110/112 112/114 110/114 106/114 106/112 114/118 110/112 110/110 112/118 108/116 116/118 108/112 112/112 112/116 112/114 114/116 112/114 116/118 112/114 112/114 114/116 RW18 199/217 193/217 195/199 193/193 189/193 187/193 193/213 189/193 193/213 193/231 195/231 193/193 195/195 195/233 193/195 -/187/189 193/193 189/195 187/195 189/213 187/193 187/197 187/193 193/197 197/199 193/195 193/193 193/193 193/199 RW31 125/125 123/125 125/127 119/125 123/125 125/125 121/123 123/123 121/131 123/123 123/123 123/125 123/125 125/125 123/125 123/123 123/125 121/123 125/125 121/125 125/125 121/121 117/121 123/125 121/123 121/125 123/125 121/123 123/123 121/125 RW410 195/203 195/205 203/211 191/205 191/203 205/207 211/211 191/211 191/211 203/211 203/207 205/211 199/205 195/205 199/211 205/211 199/211 205/205 197/211 209/211 197/197 195/211 195/211 191/195 209/211 210/211 195/209 205/209 201/205 209/209 RW48 118/120 118/126 118/120 120/126 118/126 120/120 120/124 120/126 124/124 108/118 108/122 108/118 108/118 118/120 108/126 124/126 108/126 108/124 118/120 120/122 118/118 124/124 118/124 118/124 108/122 120/122 108/118 118/120 108/120 118/122 Carroll et al: Paternity assignment & demographic closure in right whales: Supplementary Material Supplementary Table 2 continued Sample Eau03NZ03 Eau03NZ02 Eau97AI071 Eau05NZ03 Eau05NZ02 Eau06AI135 Eau06AI037 Eau06AI038 Eau06AI059 Eau07AI087 Eau07AI088 Eau95AI033 Eau07AI179 Eau07AI180 Eau98AI069 Eau07AI190 Eau07AI191 Eau07AI158 Eau07AI196 Eau07AI026 Eau98AI088 Eau08AI081 Eau08AI082 Eau08AI061 Eau08AI181 Eau08AI151 Eau07AI159 Eau09AI159 Eau09AI238 Eau06AI111 Status calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father calf mother father TR3F4 301/305 301/317 305/309 317/325 301/317 305/325 305/305 305/313 305/313 301/333 329/333 301/320 309/313 313/333 305/309 305/309 305/333 305/309 313/329 305/329 301/313 305/313 305/313 313/329 305/317 317/337 305/305 308/345 305/308 329/345 TR3G1 222/222 222/238 222/222 218/238 222/238 218/222 222/238 -/222/238 222/238 206/238 222/222 206/222 222/238 206/206 206/238 206/222 222/238 238/238 -/238/238 206/218 206/238 214/218 202/238 238/238 202/206 206/214 202/214 -/- TR3G2 168/184 172/184 168/184 172/184 172/184 172/176 168/180 168/172 168/180 176/188 172/188 172/176 176/188 176/184 176/188 172/184 172/184 168/180 172/176 172/176 172/176 180/184 176/180 180/184 176/184 176/184 176/184 176/176 176/184 176/180 GT211 85/96 85/89 96/98 85/97 -/97/101 97/99 97/103 99/99 85/103 97/103 85/85 85/97 85/97 85/97 85/99 85/99 99/103 101/103 97/103 85/101 95/103 95/97 99/103 97/103 95/103 95/97 85/101 101/103 -/- RW51 91/109 103/109 91/99 83/109 83/109 105/109 83/95 -/95/95 91/91 91/99 91/91 91/91 -/91/97 99/99 -/99/103 107/107 -/107/107 95/103 -/95/95 103/105 101/105 91/103 99/99 99/99 -/- TR3G10 214/214 214/214 214/214 214/222 214/214 206/222 214/222 206/222 214/214 214/214 214/214 214/214 214/214 214/222 214/214 214/214 214/222 214/222 214/222 214/214 214/222 214/222 214/222 214/222 214/222 214/222 206/214 -/214/214 -/-