FOR ONLINE PUBLICATION ONLY Supplementary Material 1 The specificity of degenerated primer pairs used for this study was demonstrated by DNA sequencing of the real-time quantitative RT-PCR products. The degenerated primer pair used for the amplification is shown in column 1 (for more details see material section). The corresponding DNA sequencing results are presented in column 2. The sequences were alignment against NCBI’s reference mRNA sequences (refseq_rna; blastn). Search was limited to Zea mays L. (taxid:4577). Blast hits are presented in column 3 together with the respective Genbank accession numbers. Column 4 shows the resulting description of the Blast hits. Parameters for statistical quality of the hit were presented in columns 5 - 7. Significant alignments of sequences Degenerated primer pair used for real-time quantitative RT-PCR ZmMHA_fam Sequencing summary of real-time quantitative RT-PCR products (using IUPAC base calls for wobbles) Genbank accession number ACGCCTGGTCTGCTCCTGGTCACCGCGTTCC TGCTCGCTCAACTTGTTGCCACCTTCCTC NM_001112000.1 GCTGTCTACGCCAACTGGGGCTTCGCCAGGA TCAAGGGTATCGGCTGGGGCTGGGCAGGT GTGGTCTGGCTCTACAGCATCGTCSAT TCKAGCCTGCGTGCAGCCGATGACTCCTTGC TGTGCTTGTACGGCACGATGGACGCGGCG ZmEGases (NCBI blastn on Zea mays L. [taxid:4577]; database: refseq_rna) CGGTGGTGCACCCGGCTGGGGTACTTGGGGC CGTAGCCGACGAGGTAGCTGACGCCCCTG GGGTTGGTGCCGAGCACGTAGTCCACCTGC No other Blast hits found NM_001157964.1 No other Blast hits found Description Zea mays plasma-membrane H+ATPase2 (mha2), mRNA >emb|X85805.1| Z.mays mRNA for plasma membrane H+ ATPase Zea mays endoglucanase 1 (LOC100285069), mRNA >gb|EU970755.1| Zea mays clone 350091 endoglucanase 1 precursor, mRNA, complete cds Max score/ Total score Query coverag. (%)/ Max ident (%) E value 207/ 207 95/ 93 1e53 263/ 263 93/ 99 2e70 Supplementary Material 2 a b ladder 1 Lector 2 3 1000 bp 900 bp 800 bp 700 bp 1 SR03 2 ladder 3 700 bp 600 bp 500 bp 500 bp 300 bp 200 bp 3 1 SR03 2 3 1000 bp 900 bp 800 bp 600 bp 400 bp 1 Lector 2 400 bp 300 bp 200 bp 100 bp 100 bp Demonstration of the specificity of the degenerated primer pairs ZmMHA_fam and ZmEGases. After real-time quantitative RT-PCR measurement, PCR products from both maize varieties were run on agarose gels. (a) By the use of the degenerated primer pair ZmMHA_fam for template amplification, only one single DNA band was visualized. This band appeared at the molecular size that was predicted by in-silico analysis (expected size of PCR product of plasma membrane proton pump (H+)–ATPase genes = 195 bp). (b) By the use of the degenerated primer pair ZmEGases, only one single DNA band was visualized. This band appeared at the molecular size that was expected by in-silico analysis (predicted size of PCR product of endoglucanase genes = 200 bp). PCR conditions were as described in Materials and Methods. Numbers 1-3, biological replicates of the real-time quantitative RT-PCR amplifications of Lector and SR03.Gels contain 1% agarose, Trisborate-EDTA, 0.4 µg of ethidium bromide per ml.