Supplementary Figure Legends
Figure S1
Expression of Dnm2 disease-associated mutants do not alter the integrity of
sensory neurons on a Dnm2wt/0 background
DRG explant cultures were infected with lentiviruses encoding GFP alone (pSicoRGFP), or EGFP-tagged Dnm2 WT, K44A, CMT mutants G358R, G537C, K562E,
L570H, and CNM mutant E560K. Sensory neurons were purified for twelve days
before analysis by immunocytochemistry. Confocal images indicate no detectable
differences in the levels of acetylated tubulin (that would be indicative of disturbed
microtubule dynamics) and the pattern of NF-160 staining. Scale bars: 75 m.
Figure S2
Dnm2 disease-associated mutants do not impair myelination on a Dnm2wt/wt
background
Dnm2wt/wt mouse DRG explants were infected with lentiviruses encoding GFP alone
(pSicoR), or EGFP-tagged Dnm2 WT, K44A, CMT mutant K562E, or CNM mutant
E560K. No differences in myelination ability (MBP staining) or in the neuritic
network (NF-160) were detected. Scale bars: 75 m.
Figure S3
Failure of myelination of DRG explant cultures lacking Dnm2 in Schwann cells
can be rescued by Dnm1 and Dnm3
Infection of DRG explant cultures with lentiviruses encoding EGFP-tagged Dnm2
(splice form aa), or Dnm1 (splice form aa), or Dnm3 (splice form aaa) isoforms
rescues myelination (MBP staining) on a DhhCre+;Dnm2flox/flox background (compare
to Fig. 5C (pSicoR)). The neuritic network is visualized by NF-160 staining. Scale
bars: 75 m.
Figure S4
Flow cytometry assay for quantitative CME assessment
(A) Representative scatter plot of transfected cells showing Tf-Alexa Fluor 647
fluorescence intensity in relation to EGFP expression levels. Tf-uptake is not affected
in EGFP-tagged Dnm2 WT expressing cells, while it decreases with increasing
protein expression levels of EGFP-tagged Dnm2 K562E [CMT]-transfected cells.
Gates were defined for untransfected cells (a), total expressing (b), low- (c), mid- (d)
and high- (e) EGFP. (B) In this experimental set up, Dynasore treatment impaired Tfuptake in a concentration-dependent manner compared to solvent treatment (2.5%
EtOH), or no treatment in RT4 SCs. Values represent means ± stdev of three
independent experiments: *** p<0.001, Student’s t-test.
Figure S5
Clathrin-mediated endocytosis is impaired in primary rat SCs by Dnm2 CMT
mutants
Cells were infected with lentiviruses encoding EGFP-tagged Dnm2 WT and the
indicated CMT- and CNM mutants of Dnm2 for 96 hours. Sox10 staining identifies
specifically SC nuclei. Serum-starved cells were incubated with 20 g/ml Alexa Fluor
555-labeled Tf for 30 minutes. Control (pSicoR-GFP) and WT expressing cells show
an accumulation of Tf-positive vesicles in the perinuclear region (arrows). Expression
of Dnm2 K44A and Dnm2 CMT mutants G358R, G537C, K562E and L570H impair
CME (arrowheads), while Dnm2 E560K [CNM] resembles the WT situation (arrows).
Scale bars: 15 m.
Figure S6
The biosynthetic transport of proteins to the cell plasma membrane is not altered
by Dnm2 mutants
(A) Control-infected (pSicoR) rSCs, or rSCs infected with lentiviruses encoding
Dnm2 WT, Dnm2 K44A, CMT mutants G358R and K562E, or CNM mutant E560K,
were pulse labeled with
35
S-L-methionine/L-cysteine 4 dpi for 20 min, followed by
surface biotinylation. Purified biotinylated surface proteins (beads) and total labeled
proteins (input) were analyzed by SDS page and subsequent autoradiography. (B)
Quantifications revealed no impairment in the transport of newly synthesized proteins
to the plasma membrane relative to the total of labeled proteins. Values represent
means ± stdev of three independent experiments. (C, D) In the same experimental
setting, without infection of the cells but applying Brefeldin A or Dynasore, the
expected deficit in protein biosynthesis is observed in comparison to not-treated or
solvent-treated (DMSO) cells. Values in graph represent means ± stdev of three
independent experiments: *p<0.05 **p<0.01, Student’s t-test.
Figure S7
The primary rat Schwann cell surface glycoproteome
(A) Cytoscape image of 221 identified cell surface proteins. Each node represents an
identified cell surface glycoprotein on primary rat Schwann cells. The proteins ErbB2,
integrin 1 (Itb1) and TnfR are highlighted in yellow. Availability of PubMed
references for Dnm2/clathrin dependency is indicated (diamond shape). Color code is
based on PANTHER protein class annotations: Receptor (blue), transferase (green),
cell adhesion (red), signaling molecule (rose), transporter (pink), and various
annotations (grey). (B) To ensure the efficacy of the surface biotinylation procedure,
rSCs were lentivirus-infected with Dnm2 WT and subjected to surface biotinylation,
untreated or after permeabilizing with 0.2% TritonX-100. After fixation, cells were
incubated with Cy3-streptavidin and analyzed by confocal microscopy. Arrows depict
biotinylated proteins at the plasma membrane and filopodia/membrane protrusions in
untreated cells. Arrowheads in TritonX-100-treated cells point to a highly biotinylated
pool of proteins in the nucleus and in cytoplasmic structures. Scale bars: 15 m. (C)
To validate CME-dependence of NRG-1 ligand-induced ErbB2 internalization in our
experimental set up, rSCs were infected with pSicoR-GFP for 96 hours, serumstarved for 4 h and stimulated with 20 ng/ml NRG-1 type III. Surface biotinylation
after 0, 30 and 60 minutes indicated decreased ErbB2 cell surface levels with time,
while the total protein level remained unchanged.
Supplementary Materials and Methods
MS analysis
The CSC sample was analyzed in triplicates on a LTQ-Orbitrap XL mass spectrometer
(Thermo Scientific). Peptides were loaded on a 10 cm RP-HPLC column (75 m diameter)
packed with C18 material as stationary phase (Magic C18 AQ 3 μm; Michrom Bioresources,
USA) and were further eluted over a linear 60 minute gradient of 5-30% Buffer B (2% H2O,
0.1% formic acid in acetonitrile) in Buffer A (2% acetonitrile, 0.1% formic acid, in H 2O) into
the mass spectrometer. The flow rate was set to 0.3 l per minute. Peptide ion mass to charge
range (m/z) of 350-1600 was monitored in one high resolution (60000) MS1 scan followed
by five MS2 fragmentation scans on the most intense ions in collision induced dissociation
(CID) mode. Precursor ion masses were dynamically excluded from fragmentation after CID
for 30 seconds. Singly charged ions were excluded from CID analysis.
MS data analysis
RAW data files were converted to the open mzXML data format (Pedrioli et al., 2004) and
peptide spectra were searched with a 0.04 Da mass window SEQUEST (Yates et al., 1995)
against the rat UniProt/SwissProt protein data database (2010; Jain et al., 2009). The database
was concatenated to the UniProt mouse database (version August 2010, reviewed entries) to
account for the still incomplete UniProt rat database, providing higher proteome coverage of
the CSC sample derived from homologous mouse peptide sequence matches. Furthermore,
common protein contaminants and reversed decoy sequences for each UniProt entry were
added (in total 47,909 entries). The search permitted a stable amino acid modification of
cysteine (carbamidomethylation: +57.021464 Da) and variable modifications of asparagine
(deamidation: +0.984 Da) and methionine (oxidation: +15.994915 Da). The search included
semitryptic peptide isoforms and two missed peptide cleavages.
Search results were statistically evaluated using software tools from the Trans Proteomic
Pipeline (TPP) (Keller et al., 2005) (TPP, v4.3 JETSTREAM rev 1, Build 200910221028
(linux), including Peptide Prophet (Keller et al., 2002) and Protein Prophet (Nesvizhskii et
al., 2003) for determination of correct peptide and protein identification. A peptide and
protein false discovery rate (FDR) of 1% was used for the data set.
Cell surface proteome analysis
Peptides containing a deamidated asparagine in the N-glycosylation motif consensus
sequence (NxS/T) were used for cell surface proteome analysis. Single peptide identifications
over the whole data set were excluded from further analysis. Missing entries in the rat protein
database, which were leading to unique mouse peptide identifications (in total 68
glycoproteins), were manually validated by BLAST search for further independent evaluation
of sequence homology. For 59 out of the 68 mouse protein entries the sequence homology
between rat and mouse was independently verified by protein-protein BLAST search (blastp)
against the rat RefSeq genome database. For nine glycoproteins no further independent
evidence for corresponding rat protein sequences was found (indicated in Suppl. Tab. 3).
Those 9 proteins were termed as unknown and removed from protein classification analysis.
Cell surface proteins were grouped into protein classes according to the PANTHER database
(www.pantherdb.org) (Mi et al., 2005; Thomas et al., 2003).
Primers used in this study
Tab. 1 Primers used for genotyping transgenic animals
primer
nucleotide sequence (5’ - 3’)
Dnm2 2532
Dnm2 2534
Dnm2 2536
Cre 640
gggaatcctgctggggaagctctc
ctctagcacttccactaagccctcc
gcagcatgagactatggatcaagc
ttcccgcagaacctgaagatgttcg
gggtgttataagcaatccccagaaatgc
Cre 641
Tab. 2
Forward (frw) and reverse (rev) primers to generate Dnm2 disease-causing mutations by site-
directed mutagenesis.
Dnm2 construct
nucleotide sequence (5’ - 3’)
E368K frw
E368K rev
E368Q frw
E368Q rev
R369Q frw
R369Q rev
R369W frw
R369W rev
G358R frw
G358R rev
R465W frw
R465W rev
G537C frw
G537C rev
gcatcaatcgcatcttccacaagcgctttccctttgagctgg
ccagctcaagggaaagcgcttgtggaagatgcgattgatgc
gcatcaatcgcatcttccaccagcgctttccctttgagctgg
ccagctcaaagggaaagcgctggtggaagatgcgattgatgc
cgcatcttccacgagcagtttccctttgagctggtg
caccagctcaaagggaaactgctcgtggaagatgcg
caatcgcatcttccacgagtggtttccctttgagctggtgaag
cttcaccagctcaaagggaaaccactcgtggaagatgcgattg
gtcgacaccctggagctgtctaggggcgcccgcatcaatcgc
gcgattgatgcgggcgcccctagacagctccagggtgtcgac
gtcaccacctacatctgggagcgagaagggag
ctcccttctcgctcccagatgtaggtggtgac
gcttgatgaaaggctgttccaaggagtactgg
ccagtactccttggaacagcctttcatcaagc
ggtacaaggatgaagaggaagaaaagaagtacatgctgcc
ggcagcatgtacttcttttcttcctcttcatccttgtacc
ggtacaaggatgaagaggaaaaaaagaagaagtacatgctgccac
gtggcagcatgtacttcttctttttttcctcttcatccttgtacc
ggatgaagaggaaaaagaaaaggagtacatgctgccactagac
gtctagtggcagcatgtactccttttctttttcctcttcatcc
ggatgaagaggaaaaagaaaagtacatgctgccactagac
gtctagtggcagcatgtacttttctttttcctcttcatcc
gctgccactagacaaccacaaaatacgggatgtgg
ccacatcccgtattttgtggttgtctagtggcagc
ccacatcccgtattttgtggttgtctagtggcagc
ccccagctcgcaggaacgaaggtcttccagctgtccacatcttc
ggacagctggaaggctttgttcctgcgagctgggg
ccccagctcgcaggaacaaagccttccagctgtcc
ggacagctggaaggcttggttcctgcgagctgggg
ccccagctcgcaggaaccaagccttccagctgtcc
gcttcgttcctgcgagctgggtacccagagaaggaccaggc
gcctggtccttctctgggtacccagctcgcaggaacgaagc
ccatggacccgcagctgaagcggcaggtggagacc
ggtctccacctgccgcttcagctgcgggtccatgg
K559 frw
K559 rev
E560K frw
E560K rev
K562E frw
K562E rev
K562 frw
K562 rev
L570H frw
L570H rev
A618T frw
A618T rev
S619L frw
S619L rev
S619W frw
S619W rev
V625 frw
V625 rev
E650K frw
E650K rev
Tab. 3
Results of the mass spectrometry-based cell surface capturing (CSC) approach (see supplementary online
material)