MEDICAL PROBLEM SOLVING
INTRODUCTION
The Clinic for Special Children in Lancaster County, Pennsylvania, is a
nonprofit organization that specializes on the treatment of Amish and
Mennonite children with rare metabolic disorders. Utilizing cutting
edge biotechnology and bioinformatics, the doctors and geneticists at
The Clinic have identified and described the molecular basis for
several disorders. The ability of The Clinic to identify and diagnose
affected children has drastically improved the incidence, as well as
the quality of life, for these “special children” and their families.
TASK
Imagine that you work at The Clinic for Special Children. A young,
Mennonite boy named John is brought to see you by his family. He is
suffering from diarrhea, headaches, fatigue, a sore mouth and tongue,
as well as tingling of the hands and feet. This combination of
symptoms alone is inconclusive. Therefore, The Clinic must begin
what can be called the “medical problem solving” process, in hopes of
diagnosing and treating John’s disorder.
ROLES
In a problem solving team, there are two key individuals:
1. The Doctor – meets with the patient, records symptoms,
observes and tests for other signs, provides diagnosis,
prescribes treatment
2. The Geneticist – surveys the patient’s genome, identifies and
sequences the hypothetical “problem gene,” runs a BLAST
analysis of the gene sequence, identifies the mutation and
biochemical implications
Even though both members of the team have distinct roles in the
problem solving process, it is important to remember the importance
of collaboration in science.
Choose the role that you feel suits you best. Now that you know your
role, it is time to start the process of diagnosing and treating John.
PROCESS – Listing Symptoms and Signs: The Doctor
*As good clinical practice, take careful notes and be able to
explain/describe all steps of the diagnostic process. Also, do not be
afraid to consult your supervisor.
When seven-year-old John and his family arrive at The Clinic, he is
suffering from diarrhea, headaches, fatigue, a sore mouth and tongue,
as well as tingling of the hands and feet. You also note that he is pale.
As a doctor, these symptoms automatically cause you to form a list of
possible conditions. Since you are not a real doctor, WebMD will help
you formulate this list of possible conditions. Simply identify each
symptom and answer questions if prompted to - always assume that
the answer is either moderate or unknown.
http://symptoms.webmd.com/symptomchecker
Can you determine what John has?
Keep this list of possible conditions open as a reference.
Common doctor sense suggests that running a blood test is the next
step. A complete blood count (CBC) test shows that John has low
hemoglobin levels.
Open a new window and go to MedicineNet to read about hemoglobin
and conditions characterized by low hemoglobin levels.
http://www.medicinenet.com/hemoglobin/article.htm
Which condition from the WebMD generated list is characterized by
low hemoglobin levels?
Again, common doctor sense suggests that additional blood work
needs to be done to determine the cause of this condition.
A blood smear is performed. A normal blood smear looks like this:
http://www.pathologystudent.com/?p=5230
John’s blood smear looks like this:
What differences do you notice between the normal erythrocytes (red
blood cells) and John’s?
These enlarged erythrocytes are called megaloblasts.
The additional blood work shows that John has normal levels of folate,
but low cobalamin (vitamin B12). Familiarize yourself with this
vitamin at http://ods.od.nih.gov/factsheets/VitaminB12.asp .
You decided to give him a vitamin B12 supplement, but John returns
with no change in his condition. You believe his body is not absorbing
the vitamin. Read the following article on the absorption of vitamin
B12:
http://findarticles.com/p/articles/mi_m0860/is_n2_v52/ai_8540075/
Is John lacking the intrinsic factor necessary for absorption? You run
an antibody test which shows no sign of intrinsic factor deficiency.
You also are certain to note that John does not suffer from
homocystinuria (symptoms include dislocation of eye lens, skeletal
malformations) and methylmalonic acidemia (symptoms include
feeding issues, kidney disease, pancreatitis), which should help to
narrow your search for a diagnosis.
Now it is time to collaborate with the geneticist and determine if
anything can be concluded from the survey of John’s genome.
PROCESS – Surveying and Sequencing DNA: The Geneticist
*As good clinical practice, take careful notes and be able to
explain/describe all steps of the amplification, surveying and
sequencing process. Also, do not be afraid to consult your supervisor.
When seven-year-old John arrives at The Clinic, the doctor
immediately suspects a genetic disorder is at the root of his medical
problems. His DNA is sampled and sent to you for analysis. In order to
determine which (if any) gene is causing John’s condition, you need to
survey his genome. In The Clinic’s lab, you have the ability to amplify
John’s DNA using PCR and then run a 10K microarray.
Go to the lab and amplify the DNA:
http://www.dnalc.org/ddnalc/resources/pcr.html
Look at the amplification graph – how many target copies are created
after 30 cycles?
Now you have amplified the DNA – go to the lab and run a 10K
Microarray:
http://learn.genetics.utah.edu/content/labs/microarray/
*Please note that the process in this simulation involves comparing
DNA from two types of cells, so each is labeled with a different color.
Since we are only comparing one DNA sample from John, there will be
no labeling and the results will be analyzed a bit differently. This
simulation does demonstrate the basics of the microarray process and
provides an excellent example of its use.
Wonder how they make the microarray chip? Check out this brief
video:
http://www.youtube.com/watch?v=ui4BOtwJEXs
And this simulation:
http://www.dnalc.org/ddnalc/resources/dnachip.html
The 10K microarray has identified regions of John’s genome that are
homozygous, meaning he has two copies of the same allele.
Why does homozygosity matter to you?
Hint: http://www.ncbi.nlm.nih.gov/pubmed/15558715
The microarray displays its results in an Excel file. Familiarize
yourself with the parts of this spreadsheet so that you may explain it
to the doctor and quickly examine it when hypothetical problem genes
have been identified.
Once you have identified a potential problem gene, it must be
sequenced. Review the sequencing process so that this may be done
quickly when the time comes:
http://www.dnalc.org/ddnalc/resources/cycseq.html
Now it is time to collaborate with the doctor and determine if
anything can be concluded from the list of John’s signs and symptoms.
PROCESS – Identifying and Analyzing Problem Genes: The Team
Now that a comprehensive list of John’s symptoms and signs have
been produced and his genome has been surveyed, it is time to start
identifying possible disorders and the genes they are associated with.
But first, the doctor must give a comprehensive overview of his/her
part of the process so that the geneticist has the necessary knowledge
to proceed.
Now, go to NCBI’s Online Mendelian Inheritance of Man:
http://www.ncbi.nlm.nih.gov/omim/
Together, enter combinations of John’s symptoms. Remember to use
Boolean search terms like AND, OR, NOT in all capitals. Also,
remember that using medical terms such as anemia might be more
beneficial than generic symptoms like a headache. How many hits are
you getting in the OMIM database? Are there too many/few to make
any conclusions?
Since you have surveyed John’s genome, limit the search to entries
with a known molecular basis that you will be able to check for. To do
this, go to the limits page and check the box next to the # sign. How
many hits are you getting now?
Using the various combinations of John’s symptoms, begin reviewing
the information on each disorder. Make a list of the top four or five
disorders that are good possibilities from a symptomatic standpoint.
For each of the disorders on the list, click on the link next to the gene
map locus. Using the chart below, record the name and genetic
location of genes that may be causing John’s disorder. To determine
the physical location, click on the genetic location and examine the
chromosomes for the gene you are looking for. The physical location
can be determined using the scale on the left side of the screen and
will be in millions of base pairs.
Candidate
gene
Genetic
location
Physical
location
GIF
11q13
CUBN
10p12.1
AMN
14q32
SLC56A1
17q11.1
Chr 11
55.95MB
Chr 10
17.05MB
Chr 14
102.45MB
Chr 17
23.75MB
Number
homozygous
markers
3
Size of
homozygous
region (bp)
3
4,981,811
873,898
27
9,251,483
7
5,720,239
Now it is time to examine the 10K microarray data to see if John
displays regions of high homozygosity in any of the previously
identified genes. But first, the geneticist must give a comprehensive
overview of his/her lab work so that the doctor has the necessary
knowledge to proceed.
Together, find the SNP markers in the previously identified candidate
genes using the genetic and physical locations you recorded in the
chart. Record the number of homozygous SNPs that are in a row at
each gene, as well as the number of base pairs each homozygous
region extends for.
Does your team hypothesize that any of the candidates is the problem
gene? Which one? Why?
Once the hypothetical problem gene is identified, it must be sequenced.
If the geneticist has not previously reviewed the sequencing process
with the doctor, he/she should do so at this point.
After sequencing John’s DNA, you receive the following
electropherogram and sequence:
CCGCCCCTCGCACCAGGCGCAGCCGTGGATCTGCGCGGCCCTGCTCCAGCCCCGGCCCAGGGGCAGTGC
TGTGACCTCTGTGGTAAGCGCCCCCGCCGGGCCCTGCTTGCTGGGAAGGCCTGGAGGACCAGGTTCGTC
CCCCGCCTCAGTTTCCTGCCGGGCCCGGATCCACGGCGCTGACCCCTGCCCTCCCGCCGCAGGAGCCGTT
GTGTTGCTGACCCACGGCCCCGCATTTGACCTGGAGCGGTACCGG
How can John’s sequenced DNA be of use? How will you know if the
hypothetical problem gene has a mutation?
BLAST is a sequence comparison tool that will take your sequence of
interest and compare it to more than ten million sequences that are
stored in the public database (NCBI). It will also calculate the
statistical significance of similarity for the matches it finds.
Go to BLAST:
http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PRO
GRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&
LINK_LOC=blasthome
Enter John’s sequence and BLAST with a high stringency. What kind of
results do you see? Remember that you sequenced a candidate gene so
the best match will be the reference sequence, which will likely cover
100% of John’s sequence.
Now try BLASTing John’s sequence with less stringency – choose
“more dissimilar sequences.” How have your results changed?
Finally, try BLASTing his sequence with the lowest stringency. What
are the differences in your results?
After carefully analyzing the BLAST results, is there a problem with
John’s gene? If so, what is it?
PROCESS – Treating the Patient’s Disorder – The Team
You have now successfully found the genetic cause of John’s disorder.
You have done nothing, however, to actually help John feel better! To
do so, you must formulate a treatment strategy. A good place to start
is to look at the OMIM entries for the identified disorder and gene.
Doctor – You are interested in the disorder:
http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=261100
How does John compare with other recorded clinical cases?
Geneticist – You are interested in the gene:
http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id=605799
What role does the gene play? What biochemical effect does the
mutation have on John?
Utilizing the information you both gathered, brainstorm possible
treatments that could help John.
After your discussion, consult other professionals:
http://www.nutritionmd.org/consumers/hematology/megoblastic_dia
gnosis.html
http://www.healthline.com/treatments/megaloblasticanemia__#prescriptions
http://www.vitabase.com/supplements/energy/sublingualb12.aspx
What is the best treatment plan for John?
CONCLUSION
Congratulations! You have successfully diagnosed and treated John!
He and his family are very grateful to you and The Clinic for Special
Children.
*Special Note: All information, user guides and other data has been
adapted from an activity used during the 2009 Bioinformatics
Seminar at Franklin & Marshall College, in conjunction with The Clinic
for Special Children. Biology department faculty from F&M College
and doctors from The Clinic designed the original activity this
WebQuest is based on.