MATERIALS AND METHODS FOR SUPPLEMENTAL MATERIAL
Generation and overexpression of mutant alleles - Human lipin 1 cDNA in the pENTRTM
vector was a gift of Andrew Morris. Changes in nucleotide sequence corresponding to known
lipin 1 mutations were introduced into the cDNA by using site-directed mutagenesis via the
QuikChangeII XL Site-Directed Mutagenesis Kit (cat. 200521; Agilent Technologies, Santa
Clara, CA). WT and mutant cDNAs were the transferred to pcDNA3.1/nV5-DESTTM fusing a
V5 epitope tag to the N-terminus of the protein (Life Technologies/Invitrogen, Carlsbad CA).
HEK293 cells were transfected with vectors driving expression of WT or mutant proteins for
analysis of mRNA and protein expression, subcellular localization, protein half-life, and PAP
activity. For kinetic analyses WT, p.Leu635Pro, and p.Arg725His lipin 1 cDNA were transferred
to pCMVTAG2 (Agilent) and then inserted into the pAdTRACK-CMV vector for adenoviral
production using the AdEASY system (He et al 1998).
Immunohistochemistry on human tissue – Frozen muscle biopsies were mounted on a block
in a cryostat, and 10 µm sections were placed on a Superfrost Plus microscope slides (cat. 12550-15; Thermo Fisher Scientific, Rochester, NY). Slides were fixed in -20°C cooled acetone
and placed in coplin staining jars at -20°C for 10 min. Slides were blocked, and then a 1:100
dilution of lipin 1 antibody against the c-terminal region (Harris et al 2007) was applied for two
hours at room temperature. Slides were washed in PBS for 10min and Alexa Fluor 594 goat
anti-rabbit (cat. A-11012; Life Technologies, Grand Island, NY) was applied for three hours.
Slides were washed three times for 5 min with PBS before coverslip mounting using ProLong
Gold Antifade Mountant with DAPI (cat. P36935; Life Technologies, Grand Island, NY). For
muscle histochemistry, cryostat sections of rapidly frozen muscle were processed, as previously
described (Mozaffar and Pestronk 2000; Miller et al 2002).
Protein isolation for western blotting - Protein from cultured cells was isolated in ice-cold
homogenization buffer (25 mM HEPES, 150 mM NaCl, 5 mM EDTA, 1% Triton X-100, pH 8.0)
supplemented with 1 mM activated Na3VO4, 1 mM phenylmethanesulfonyl fluoride, 5 mM
sodium fluoride, and 1X Complete protease inhibitor cocktail (Roche, Manneheim, Germany).
Protein concentration was determined by BCA assay (Pierce Biotechnology). Lysates were
stored at -80°C.
Lysates were subjected to SDS-PAGE and transferred to PVDF membranes. Blots were then
rinsed with Tris-buffered saline plus Tween (TBST) (0.14 mol/l NaCl, 0.02 mol/l Tris base, pH
7.6, and 0.1% Tween), blocked with 5% BSA in TBST for 1 h at room temperature, washed 3 x
10 min at room temperature, and incubated with the relevant primary antibody 1:1000 in 5%
BSA overnight at 4°C. Blots were then washed 3 x 5 min with TBST, incubated with relevant
secondary antibodies for 1 h at room temperature, washed again 3 x 10 min with TBST, and
washed 2 x 10 min with TBS. Protein bands were visualized using the Odyssey Imaging System
(LiCor Biosciences). Lipin 1 antibody (cat. sc-98450) was obtained from Santa Cruz (Dallas,
TX). Anti-alpha-Tubulin Clone B-5-1-2 (cat. T5168) and Anti-V5 (cat. V8012) was purchased
from Sigma-Aldrich (St. Louis, MO). Goat anti-mouse IRDye 680 (cat. 926-32220), goat antirabbit IRDye 680 (cat. 926-68021), and goat anti-rabbit 800 (cat. 926-32211) secondary
antibodies were obtained from LiCor Biosciences (Lincoln, NE).
Quantitative RT-PCR Analyses - Total RNA was isolated in RNA-Bee as per the
manufacturer’s instructions. Total RNA was subjected to reverse-transcription and Power
SYBR-Green RT-PCR (Applied Biosystems, San Francisco, CA) according to the
manufacturer’s instructions. Results were normalized to 36B4 expression. Primer sequences
were: lipin 1 fwd: AGTCAGCC TCATACCCTAATTCGG, lipin 1 rev:
GGCAAGAACTAGACAGACCTCCCT, 36B4 fwd: GCAGACAACGTGGGCTCCAA
GCAGAT, 36B4 rev: GGTCCTCCTTGGTG AACACGAAGCCC.
Protein Half-Life - Lipin 1 and mutant expression vectors were transfected into HEK293
cells in 12 well plates. Pulse-chase labeling of the cells was achieved by (following 1 wash in
PBS) incubating the cells in the pulse media consisting of Cys/Met-depleted media (Life
Technologies/Gibco, Carlsbad, CA) supplemented with [35S]Cys/Met EasyTag Express Protein
Labeling Mix (Perkin Elmer, Waltham, MA) for 30 minutes at 37°C. Pulse media was aspirated
and chase media consisting of DMEM containing 10 mM Met and 3 mM Cys was applied for 1,
2, or 4 hours. Lysates were collected in homogenization buffer described above. Following a
protein content determination, lysates were incubated with lipin 1 antibody overnight at 4°C. The
protein-antibody complex was pulled down with Protein A agarose beads (Millipore; Billerica,
MA) for 1 h at 4°C. The protein-antibody-bead complex was washed 3 times with PBS, the
protein-antibody complex was removed with 2x Laemmli buffer (Bio-Rad, Hercules, CA) for 5
min at 37°C. The proteins were subjected to SDS-PAGE. The gel was washed for 30 min in 10%
acetic acid, rinsed thoroughly in water, and incubated for 30 min in Fluoro-hance
autoradiography enhancer (Research Products International, Mount Prospect, IL). The gel was
dried on to whatman paper and analyzed by autoradiography on film.
Immunofluorescent staining and cellular distribution – Cos7 cells were plated on Lab-Tek II
tissue culture chamber slides (Thermo Fisher Scientific, Rochester, NY) and expression vectors
for lipin 1 WT and mutant proteins were transfected into the cells 12 hours later. Twenty-four
hours after transfection, cells were fixed in 2% formaldehyde in PBS for 20 min at room
temperature, rinsed in PBS, and incubated with anti-V5 and anti-calnexin (cat. ADI-SPA-860;
Enzo Life Sciences, Farmingdale, NY) in microscopy buffer containing 1% BSA, 0.1% saponin,
and 0.02% NaN3 in PBS for 1 h at room temperature. Following, cells were rinsed with PBS and
incubated in microscopy buffer for 1 h containing 1.8μM 4’6-diamidino-2-phenylindole (cat.
COMP, LOC) and secondary antibodies Alexa Fluor 488 donkey anti-mouse (cat. A-21202) and
Alexa Fluor 594 goat anti-rabbit (cat. A-11012; Life Technologies, Grand Island, NY). Cells
were washed with PBS and coverslips were mounted using mounting media. The cells were
visualized by fluorescence miscroscopy using a Nikon Eclipse TE2000-U driven by MetaMorph
version 6.2r6 software (Molecular Devices, Sunnyvale, CA) and the subcellular distribution of
proteins between the cytoplasm and nucleus was evaluated as described previously (Ren et al
2010).
Transcriptional Regulation by Dual-Luciferase Reporter Assay - Cos7 cells were plated in 24
well plates the day before the assay. The ability of lipin 1 to coactivate overexpressed Gal4PGC-1 and MEF2A was assayed by cotransfection of WT, p.Leu635Pro, or p.Arg725His lipin
1 (or vector control) with the Gal4-reponsive UAS thymidine kinase luciferase construct (Barger
et al 2000). SV40-driven Renilla luciferase expression vector was also co-transfected to assess
transfection efficiency. Firefly and Renilla luciferase were assessed using the Dual-Glo
Luciferase Assay System (Promega) according to the manufacturer’s instructions.
PAP Activity - PAP-1 activity was assessed as described (Martin et al 1987) with
modifications. Transfected cultured HEK293 cells were washed with PBS, dislodged from 6 or
12-well plates, and homogenized in lysis buffer (0.01 M Tris-HCl [pH 7.3], 0.25 M Sucrose,
0.5% Tween-20, 1 mM DTT, 1x EDTA-free protease inhibitor (Roche, Manneheim, Germany)
and protein concentration determined. 14C-phosphatidic acid (PA) was prepared as follows: 15
µL 0.1 mCi/mL of the 14C-PA L-α-dioleoyl [oleoyl-1-14C] Na salt (cat. 1303; American
Radiolabeled Chemicals, Inc, St. Louis, MO) was added to 3 mM 3-sn-PA sodium salt (cat.
P9511; Sigma Aldrich) and 2 mM L-α-phosphatidylcholine (cat. P3556; Sigma Aldrich) in 1000
L of chloroform, evaporated under stream of N2, and resuspended in 1 mL of ice cold dd-H2O.
This mixture was sonicated 3 x 10 seconds and kept on ice in-between sonications. To run the
assay reaction, 5 µL of each sample was incubated in 40 µL of assay buffer (0.1 M Tris/Maleate,
[pH 6.9], 10 mM MgCl2, 0.2% fatty acid-free bovine serum albumin, 1 mM DTT, and 1x EDTAfree protease inhibitor with or without 12.5 mM N-ethylmaleimide (Sigma Aldrich, St. Louis,
MO)), with 5 µL of 14C-PA at 37°C for 20 min. The reaction was stopped by adding 1 mL of a
19:1 (v/v) cholorform/methanol mixture containing 0.8% olive oil to each reaction and vortexing
briefly. 500 mg of dry aluminum oxide was added to the tubes and capped securely. Three cycles
of vortexing for 30 seconds were performed. Samples were spun down at 10,000xg for 5 minutes
and 350 µL of sample was added to scintillation fluid to count the 14C radioactivity.
Kinetic analysis - FLAG tagged-WT, p.Leu635Pro, and p.Arg725His lipin 1 proteins were
expressed in HeLa cells with 72 h adenoviral infection with a multiplicity of infection of ~10.
Cells were harvested by centrifugation at 900 x g for 10 min and then washed with ice cold
phosphate-buffered saline (PBS). All subsequent steps were carried out on ice or at 4°C unless
otherwise noted. Cells were lysed in buffer A (150 mM NaCl, 0.1% Brij 35, and 20 mM Hepes,
pH 7.2), centrifuged for 16,000 g for 10 min and the supernatant was incubated with anti-FLAG
beads for 2-4 h. Beads were isolated by centrifugation at 500 g and the supernatant was removed.
After washing, the slurry was incubated for 30 minutes at 30°C in 100 mM NaCl, 1 mM MnCl2,
2 mM DTT 50 mM Hepes, pH 7.2 and subjected to gentle agitation. The slurry was packed onto
a screening column, washed with five column volumes of buffer A, followed by five column
volumes of buffer A containing 500 mM NaCl, and lipin 1 proteins were eluted by five
successive additions of an equal volume of 0.5 mg/mL FLAG peptide in buffer A. Elution
fractions containing lipin were pooled and dialyzed three times against 1 L 150 mM NaCl, 10%
glycerol and 20 mM Hepes, pH 7.2. Purified lipin 1 proteins were quantified using UV
absorbance and comparison of bands of lipin and bovine serum albumin standards on Coomassie
Blue-stained SDS-PAGE gels. PAP assays were performed at pH 7.5 with Triton X-100/PA
mixed micelles as previously described (Eaton et al 2013).
Statistical Analysis - Statistical analyses were done using Microsoft Excel 2013 (Seattle,
WA). Data were expressed as means ± SEM. Unpaired t-tests were used to determine significant
differences. A P value of <0.05 was considered statistically significant. The kinetic data was
analyzed using GraphPad Prism 5 using the Michaelis-Menten equation. kcat was calculated
according to the equation kcat =Vmax/Et, where Et=enzyme catalytic site concentration.
REFERENCES FOR SUPPLEMENTAL MATERIAL
Barger PM, Brandt JM, Leone TC, Weinheimer CJ, Kelly DP (2000) Deactivation of peroxisome
proliferator-activated receptor-alpha during cardiac hypertrophic growth. J Clin Invest
105: 1723-1730.
Eaton JM, Mullins GR, Brindley DN, Harris TE (2013) Phosphorylation of lipin 1 and charge on
the phosphatidic acid head group control its phosphatidic acid phosphatase activity and
membrane association. J Biol Chem 288: 9933-9945.
Harris TE, Huffman TA, Chi A, et al (2007) Insulin controls subcellular localization and
multisite phosphorylation of the phosphatidic acid phosphatase, lipin 1. J Biol Chem 282:
277-286.
He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B (1998) A simplified system for
generating recombinant adenoviruses. Proc Natl Acad Sci U S A 95: 2509-2514.
Martin A, Hales P, Brindley DN (1987) A rapid assay for measuring the activity and the Mg2+
and Ca2+ requirements of phosphatidate phosphohydrolase in cytosolic and microsomal
fractions of rat liver. The Biochemical journal 245: 347-355.
Miller T, Al-Lozi MT, Lopate G, Pestronk A (2002) Myopathy with antibodies to the signal
recognition particle: clinical and pathological features. Journal of neurology,
neurosurgery, and psychiatry 73: 420-428.
Mozaffar T, Pestronk A (2000) Myopathy with anti-Jo-1 antibodies: pathology in perimysium
and neighbouring muscle fibres. Journal of neurology, neurosurgery, and psychiatry 68:
472-478.
Ren H, Federico L, Huang H, et al (2010) A phosphatidic acid binding/nuclear localization motif
determines lipin1 function in lipid metabolism and adipogenesis. Mol Biol Cell 21: 31713181.
FIGURE LEGENDS FOR SUPPLEMENTAL MATERIAL
FIGURE S1. Alignment of mutant lipin 1 with lipin 2 and 3 protein sequences. The catalytic
site (DIDGT) for phosphatidic acid phosphohydrolase (PAP) activity and other haloacid
dehalogenase (HAD) domains that are important for regulating PAP activity are noted. The
nuclear receptor interaction domain (NRID) is important for transcriptional regulatory function.
Amino acid substitutions or deletions in lipin 1 mutant alleles are in red font.