Protocol for inactivation of the genes in Yersinia pestis
The method is based on phage lambda Red recombinase system described by Datsenko and Wanner (1)
Summary
First, plasmid encoding lambda Red recombinase under arabinose inducible promoter is introduced to Y. pestis
by electroporation. The original plasmid pKD46 (ApR) expressing lambda Red was modified to add sacB gene
in order to facilitate the further removal of this helper plasmid by selection on sucrose. We found that it is often
difficult to get rid of the pKD46 otherwise. Then, Y. pestis/pKD46sacB is electroporated with the PCR fragment
containing the kanamycin resistance cassette (KmR) with the FRT sites flanked by the sequences homologous to
the target gene. We observed that the efficient insertion of KmR in Y. pestis often requires a longer homology
area than that in E. coli. Typically, we use flanking sequences of 85 bp. The recombinant Y. pestis clones appear
on Heart Infusion Broth (HIB) plates containing 35 ug/ml of kanamycin in 3 days. The insertion is verified by
PCR using another pair of flanking primers distant to the region of homologous recombination. Four clones
confirmed for the replacement of the target gene with the KmR marker are saved. One of these clones is taken
for further work by plating on HIB agar supplemented with 10% of sucrose. Resulting colonies lost pKD46sacB
that is verified by testing the clones on HIB with ampicillin, as well as PCR with the primers specific to sacB
and gam (lambda recombinase) genes. Two selected clones are tested for the pigmentation phenotype on Congo
Red plates and the low-calcium response phenotype on magnesium-oxalate agar plates. The next step is
elimination of the KmR cassette, which is surrounded with directly repeated FRT sites (FLP recombinase
target). To perform this step, the KmR-mutant is transformed with the plasmid pFLP2 (ApR) (2) containing FLP
recombinase and the sacB gene. Ten individual colonies of transformants are tested for the loss of KmR marker
on HIB-kanamycin plates followed by validation by PCR with the flanking primers within the target gene. One
KmS clone is selected for further work. To cure pFLP2, this clone is plated on HIB agar supplemented with 10%
of sucrose. The loss of ApR marker is verified by plating on HIB-ampicillin, as well as by PCR with primers
specific to sacB and flp genes. Two selected clones are tested for the pigmentation phenotype on Congo Red
plates, the low-calcium response phenotype on magnesium-oxalate agar plates, fibrinolytic activity on the fibrin
plates, and multiplex PCR for the presence of three Y. pestis plasmids pPCP1, pCD1, and pMT1.
The resulting knock-out mutants of Y. pestis contain the deletion of the target gene corresponding to the regions
of homologous recombination and the scar that includes the FRT sequence. The mutant does not contain the
antibiotic resistant markers, helper plasmids or any foreign genes.
Step by step Protocol
1. Prepare electrocompetent cells of the recipient Y. pestis strain containing pKD46sacB and arabinoseinduced lambda recombinase (Supplemental 2).
2. Prepare PCR fragment containing KmR-cassette and homology regions to the target gene (Supplemental
3).
3. Electroporate 2 ul of the PCR fragment to the 25 ul of arabinose-induced electrocompetent
Y.pestis/pKD46sacB using MicroPusler BioRad; 0.1 cm cuvette, 1.8 kV voltage and pulse time is
typically in the range of 3.5-5.5 msec. Allow bacteria to recover in 1 ml of HIB with 0.2% L-arabinose
for 2 hours at 30°C. Plate ~0.2 ml on five HIB plates containing 35 ug/ml of kanamycin, incubate at
26°C for 3 days.
4. Plate eight colonies on HIB-Km agar, suspend ½ of the loop of bacteria in 200 ul of H2O, boil for 10
min, put on ice for 5 min, spin for 5 min, collect supernatant. This is a template for the PCR assay.
5.
Conduct PCR of eight selected clones using primers flanking the region of recombination to verify the
deletion of the target gene and the insertion of the KmR-cassette. Prepare glycerol stocks of four
recombinant clones to keep until the final version of the knock-out mutant is produced.
6. Take one recombinant clone for further work: prepare bacterial suspension in saline at OD600= 1.0 and
make 10-fold dilutions. Plate 100 ul from dilutions -3, -4 and -5 to HIB containing 10% sucrose.
7.
Incubate at 26°C until separate colonies will appear. These are the clones that lost the helper plasmid
pKD46sacB.
8. Verify that the helper plasmid was cured by testing the colonies on HIB-ampicillin plates (should be
negative) and by PCR with the primers detecting sacB and gam genes.
9. Test two independent clones of the KmR mutant for Pgm+ (Supplemental 4) and Lcr+ (Supplemental 5)
phenotypes by plating bacteria in 10-fold dilutions on Congo Red and magnesium oxalate plates,
respectfully. Use one clone for further steps.
10. Prepare electrocompetent cells of the KmR mutant and transform it with plasmid pFLP2 coding for FLP
recombinase. Select colonies on HIB plates with ampicillin 50 ug/ml.
11. Test 10 colonies of transformants by spotting them on HIB-Km and HIB-Ap plates, select KmSApR
clones.
12. Verify the loss of KmR marker by PCR using flanking primers to the target gene that were employed at
step 5. Use one clone for further steps.
13. Similarly to step 6, prepare bacterial suspension in saline at OD600= 1.0 and make 10-fold dilutions.
Plate 100 ul from dilutions -3, -4 and -5 to HIB containing 10% sucrose. Incubate at 26°C until separate
colonies will appear. These are the clones that lost the helper plasmid pFLP2.
14. Verify that the helper plasmid was cured by testing the colonies on HIB-ampicillin plates (should be
negative) and by PCR with the primers detecting sacB and flp genes. Select one clone for the final step.
15. Test selected KmSApS knock-out mutant for Pgm+ and Lcr+ phenotypes, as done at step 8. If applicable,
test for the fibrinolytic activity (Supplemental 6). Verity the presence of three Y. pestis plasmids pPCP1,
pCD1, and pMT1 by PCR with primers detecting pla, yopE, and caf1 genes, respectively.
Supplemental 1. Plasmids and primers.
Table 1. Plasmids used in the protocol
Plasmid
Characteristic
R
pKD46
Ap , Red recombinase expression plasmid
pKD46sacB pKD46 containing sucrose selection sacB gene
pKD4
KmR, template plasmid
pFLP2
ApR, FLP recombinase expression plasmid
Table 2. Primers used in the protocol
Name
Sequence
K1
CAGTCATAGCCGAATAGCCT
K2
CGGTGCCCTGAATGAACTGC
sacB_F.det CACAAGAATGGTCAGGTTCAGC
sacB_R.det TGACGGAAGAATGATGTGCTTT
gam_F.det
cattcactaaccccctttcctg
gam_R.det accatgtaccggatgtgttctg
Reference
(1)
This study
(1)
(2)
Target /purpose
kan/to verify upstream junction
kan/to verify downstream junction
sacB/detection of pKD46sacB and
pFLP2
gamB/detection of pKD46sacB
Reference
(1)
(1)
This study
This study
flp_F
flp_R
pla_F
pla_R
yopE_F
yopE_R
caf1_F
caf1_R
GTGCTTGTTCGTCAGTTTGTGG
CCAGATGCTTTCACCCTCACTT
TATTCTGTCCGGGAGTGCTAAT
ATAATAACGTGAGCCGGATGTC
GGATCTAGCAGCGTAGGAGAAA
AGAAGGGAATACCACAAACAGG
GCTTACTCTTGGCGGCTATAAA
TACGGTTACGGTTACAGCATCA
flp/detection of pFLP2
This study
pla/detection of pPCP1
This study
yopE/detection of pCD1
This study
caf1/detection of pMT1
This study
Supplemental 2. Electrocompetent cells of Y. pestis.
1. Plate Y. pestis on HIB from the glycerol stock, incubate 36 hours at 26°C.
2. Inoculate 5 ml of HIB and grow overnight at 26°C.
3. Read OD600, and inoculate 5 ml of fresh HIB with overnight culture to starting OD600= 0.1, and grow to
an OD600= ~0.6. If the Red recombinase is needed to be induced in Y. pestis/pKD46sacB, add Larabinose to concentration of 0.2% for the final 1.5-2 hours of growth. The final OD600 is typically in the
range of 0.8-1.0.
4. Harvest cells, wash 3 times with 1 ml of cold 10% glycerol. Finally, suspend in 50 ul of 10% glycerol.
Supplemental 3. Preparation of PCR fragment for mutagenesis.
1. Use pKD4 plasmid DNA as a source of KmR cassette as described in the original paper of Datsenko and
Wanner (1).
2. Make 6 X 50 ul PCR reactions with pKD4 as a template, and long primers that can anneal to the pKD4
and containing 85 bp homology to the target gene. The use of Phusion DNA polymerase (New England
Biolabs) is recommended.
The amplification conditions are the following: 95 C- 1 min; 35 cycles-95 C – 30 sec, 58 C – 30 sec, 72 C –
2 min, and the extension is 72 C – 10 min.
3. Combine all reactions together and purify the PCR fragment from gel by using Qiagen gel- purification
kit (QIAquick Gel Extraction Kit Cat. No. 28704).
4. Treat isolated fragment with DpnI, and clean DNA with the Qiagen PCR purification kit (QIAquick
PCR Purification Kit Cat. No. 28106).
5. Concentrate eluted fragment to 10 ul by ethanol precipitation. Use 2 ul for electroporation.
Supplemental 4. Testing for Pgm+ phenotype on Congo Red plates.
4a. Preparation of Congo Red plates
Reagents and solutions
Use deionized Milli-Q water for preparation of all solutions.
Congo Red (CR) agar
10g Heart Infusion Broth (HIB; Difco; Cat. No.238400)
15 g Bacto Agar (Difco; Cat. No.214010)
0.1 g Congo red (ICN; Cat. No.105099)
980 ml water
20 ml filter sterilized 10% (w/v) D-galactose (Fisher Scientific; Cat. No.BP656)
1. Mix HIB, Bacto Agar, and CR with water (omit galactose) and autoclave.
2. Aseptically add galactose after autoclaving.
3. Mix by swirling flask then pour 20 to 25 ml of media into plates.
4. Allow plates to harden. Store up to several months at 4◦C.
4b. Testing of clones for Pgm+ phenotype on Congo Red plates
Preparation of culture to test on Congo Red plates
1. Take clone to prepare bacterial suspension in saline at OD600= 1.0.
2. Make 10-fold dilutions.
3. Plate 100 ul from dilutions -3, -4 and -5 on plates.
4. Use glass beads to spread the culture.
5. Incubate plates at 26ºC for three days. The Pgm+ colonies appear red in color.
Supplemental 5. Testing for Lcr+ phenotype on magnesium-oxalate plates.
5a. Preparation of Magnesium Oxalate agar/dextrose
For 0.5 L of medium:
12.5 g Heart Infusion Broth (HIB)
8 g Bacto Agar
410 ml water
Put magnetic bar there
1. Autoclave, cool to 55ºC in water bath.
Prepare Stocks:
0.25M Na2C2O4 (NaOx)
0.5 M MgCl2
2. Sterilize by filtration.
Add slowly using magnetic stirring:
3. 46 ml of 0.25M NaOx warmed to 50ºC and after complete mixing.
4. Add slowly 46 ml 0.25 M MgCl2 warmed to 50ºC.
5. Finally, add 5.0 ml of 1M dextrose (~20% dextrose).
6. Pour plates immediately.
7. Use disposable spreaders, to spread the bacterial culture on MgOx plates.
5b. Preparation of culture to test on MgOx plates
1. Take clone to prepare bacterial suspension in saline at OD600= 1.0.
2. Make 10-fold dilutions.
3. Plate 100 ul from dilutions -3, -4 and -5 on MgOx plates.
4. Incubate plates at two temperatures 26ºC and 37ºC.
5. Count colonies on around day three. The phenotype is considered Lcr+, if the number of colonies grown at
26°C is a few logs more than that at 37°C.
Supplemental 6. Testing for fibrinolytic activity.
6a. Preparation of fibrin plates
Reagents from Sigma:
F8630, fibrinogen from bovine plasma, type I-S, 5g
T4648, thrombin from bovine plasma, 1,000 units
Fibrinogen solution: 2.5g mg/ml of borate buffer
Thrombin solution: 50 units per ml of borate buffer
Borate buffer (1L)
H3BO3 11.25 g
Na2B4O7 x 10H2O 4.0 g
NaCl 4.25g
Check pH by indicator paper, should be ~7.7
1. Add 10 ml fibrinogen solution to one side of a Petri dish.
2. Add 0.5 ml thrombin solution to the other side.
3. Swirl plate to mix reagents thoroughly. Clotting appears rapidly.
4. Spot 4ul of test solution onto surface of film and incubate at 37C.
5. Look for clearing of fibrin for a positive fibrinolytic activity.
References
1.
Datsenko KA, Wanner BL. 2000. Proc Natl Acad Sci U S A 97: 6640-5.
2.
Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998. Gene 212: 77-86