Supplementary Table 1 Bacterial strains and plasmids used in this study
Strain or plasmid
Genotype
Reference
MG1655
Wild type strain VKPM B-6195
VKPM
MG lacIQ
MG1655 single CG->TA change at −35 of the
promoter region of lacI (causing lacI Q)
This study
MG lacIQ adhE
MG1655 lacIQ λattR-cat-λattL-Ptrc-ideal-4-SDφ10adhE
This study
MG lacIQ adhEΔ
MG1655 lacIQ λattR-cat-λattL-Ptrc-ideal-4-SDφ10adhE::kan
This study
MG lacIQ adhE568
MG1655 lacIQ λattR-cat-λattL-Ptrc-ideal-4-SDφ10adhE(Glu568Lys)
This study
MG adhE568
MG1655 lacIQ attB-Ptrc-ideal-4-SDφ10adhE(Glu568Lys)
This study
MG lacIQ atoB
MG1655 lacIQ λattR-cat-λattL-Ptrc-ideal-4-SDφ10atoB
This study
MG lacIQ fadB
MG1655 lacIQ λattR-cat-λattL-Ptrc-ideal-4-SDφ10fadB
This study
MG lacIQ fadE
MG1655 lacIQ λattR-cat-λattL-Ptrc-ideal-4-SDφ10fadE
This study
BOX-1
MG1655 lacIQ attB-Ptrc-ideal-4-SDφ10adhE(Glu568Lys)
This study
Strain
attB-Ptrc-ideal-4-SDφ10-atoB
BOX-2
MG1655 lacIQ attB-Ptrc-ideal-4-SDφ10adhE(Glu568Lys)
This study
attB-Ptrc-ideal-4-SDφ10-atoB attB-Ptrc-ideal-4-SDφ10fadB
BOX-3
MG1655 lacIQ attB-Ptrc-ideal-4-SDφ10adhE(Glu568Lys)
attB-Ptrc-ideal-4-SDφ10-atoB attB-Ptrc-ideal-4-SDφ10-
This study
fadB
attB-Ptrc-ideal-4-SDφ10-fadE
Plasmid
pMW-Olac-idealPtrc/Olac-ideal-lacZ
pSC101, bla, Olac-ideal-Ptrc/Olac-ideal-lacZ
(Skorokhodova et al.
2006)
pSC101, bla, cat, λattL-cat-λattR cassette
(Katashkina et al.
2005)
pKD46
pINT-ts, bla, ParaB-λgam-bet-exo
(Datsenko and
Wanner 2000)
pMWts-Int/Xis
pSC101-ts, bla, PR-λxis-int, cIts857
(Gulevich et al. 2009)
pUC4K
pBR322, bla, kan
Pharmacia
pMW118-(λattLCm-λattR)
Supplementary materials and methods
Construction of bacterial strains
All modifications in the E. coli MG1655 chromosome were obtained by the method of
Datsenko and Wanner (2000). In this study, the phage λ Xis/Int system instead of FLP
recombinase was used to excise the selective marker. All of the oligonucleotides that were used
are listed in Supplementary Table 2.
Plasmid pMW-Olac-ideal-Ptrc/Olac-ideal-lacZ (Skorokhodova et al. 2006) was used as a
template for the PCR amplification of the Olac-ideal-Ptrc/Olac-ideal promoter, further designated as
Ptrc-ideal-4. Plasmids pMW118-(λattL-Cm-λattR) (Katashkina et al. 2005) and pUC4K
(Pharmacia) were used as templates for the PCR amplification of DNA fragments carrying the
chloramphenicol acetyltransferase (cat) and aminoglycoside 3`-phosphotransferase (kan) genes,
respectively. Plasmid pKD46 (Datsenko and Wanner 2000) was used as a helper for the λRedmediated integration of the linear DNA fragments into the bacterial chromosome. The plasmid
pMWts-Int/Xis (Gulevich et al. 2009) was used as a helper for λInt/Xis-mediated excision of the
selective marker from the bacterial chromosome.
The DNA fragment for the construction of strain MG1655 lacIQ was obtained as follows:
The cat gene, flanked by λattR and λattL, was obtained by PCR using primers P1 and P2,
and the pMW118-(λattL-Cm-λattR) plasmid as a template. The PCR product was integrated into
the chromosome of MG1655 and the CmR marker was eliminated. The presence of the lacIQ
mutation (GTGCAA) in the -35 region of PlacI promoter in the clones was confirmed by
sequence analysis using primers P3 and P4. Thus, the strain MG1655 attB-PlacIQ-lacI, named MG
lacIQ, was obtained.
The construction of the DNA fragments to substitute for the native regulatory regions of
the adhE, fadE, fadB and atoB genes by the artificial genetic element Ptrc-ideal-4-SDφ10, which
contained an efficiently repressed strong LacI-dependent promoter (Ptrc-ideal-4) and a ShineDalgarno sequence (SD sequence) of the φ10 gene from phage T7, was performed in several
steps. First, the DNA fragments containing an artificial regulatory element and a BglII restriction
site were obtained by PCR using primers P5 and P6 and the plasmid pMW-Olac-ideal-Ptrc/Olac-ideallacZ as a template. The PCR product was used for the next round of PCR as a template. Primers
P5 and P7, P5 and P18, P5 and P22, and P5 and P26 were used. Primers P7, P18, P22 and P26
contain the regions that are complementary to the 5`-end of the open reading frames of adhE,
fadE, fadB and atoB genes, respectively. At the same time, the DNA fragments containing the
BglII restriction site, the CmR marker encoded by the cat gene and sequences homologous to the
DNA regions upstream of the coding regions of the corresponding genes were obtained by PCR
using primers P8 and P9, P9 and P19, P9 and P23, and P9 and P27 and the pMW118-(λattL-CmλattR) plasmid as a template. The pairs of DNA fragments were digested with BglII restrictase
and then ligated using T4 DNA ligase. The products obtained after ligation were amplified by
PCR using primers P7 and P8, P18 and P19, P22 and P23, and P26 and P27. The PCR products
were separately integrated into the chromosome of strain MG1655 lacIQ, and then the marker
was eliminated. The correspondence between the desired and the obtained structure of the new
hybrid regulatory element introduced upstream of the coding regions of adhE, fadE, fadB and
atoB genes was confirmed by sequence analyses using primers P10 and P11, P20 and P21, P24
and P25, P28 and P29, respectively.
The introduction of the point mutation Glu568Lys into the coding region of adhE gene
was performed in two steps. Initially, a region of 21 nucleotides, including codon 568 of the
corresponding gene, was replaced by a DNA fragment containing the KmR marker encoded by
the kan gene. Then, the introduced marker was replaced by an artificial double-stranded
oligonucleotide containing the earlier deleted region of adhE gene, but including the mutation
leading to the Glu568Lys substitution in the protein product of the gene. The DNA fragment
containing the KmR marker encoded by the kan gene was obtained by PCR using primers P12
and P13 and pUC4K plasmid as a template. Obtained PCR product was integrated into the
chromosome of strain E. coli MG1655 lacIQ λattR-cat-λattL-Ptrc-ideal-4-SDφ10-adhE (MG lacIQ
adhE). The correspondence between the desired and obtained chromosomal structure of selected
CmRKmR colonies was confirmed by PCR analysis using the locus-specific primers P14 and P15.
The mutant strain was named MG lacIQ adhEΔ. The target double-stranded oligonucleotide for
the substitution of the KmR marker in the coding region of the adhE gene was obtained by PCR
using the partially overlapping primers P16 and P17. Primers P16 and P17 contain nucleotides
necessary for the desired substitution in the protein product of the adhE gene in the overlapping
region and 36 non-overlapping nucleotides necessary for the integration of a duplex into a
chromosome. The PCR product (93 base pairs) was integrated into the chromosome of strain MG
lacIQ adhEΔ. The selection of adhE+-recombinants was made under aerobic conditions on M9
plates containing IPTG (1 mM) and ethanol (1%) as a sole carbon source. The correspondence
between the desired and obtained nucleotide structure of the 568 codon region of the adhE gene
in the chromosome of selected adhE+ CmRKmS colonies was confirmed by sequence analysis
using the locus-specific primers P14 and P15. After eliminating the CmR marker, the MG1655
lacIQ attB-Ptrc-ideal-4-SDφ10-adhE(Glu568Lys) strain, named MG adhE568, was obtained.
The individual modifications were combined in the chromosome of the resulting BOX-3
strain by the sequential P1-mediated transductions.
Analytical techniques
GC-MS was used to identify 1-butanol in culture media. For GC-MS analysis, a HewlettPackard 6890 gas chromatograph equipped with an autosampler 7683 with an HP 5973 mass
selective detector was used. An OmegaWax (Supelco) fused-silica column (30 m, 0.25 mm i.d.,
0.25 μm film thickness) was used. Helium was used as the carrier gas at a constant flow of 1.0
ml/min. The column oven was programmed from 45°C (hold 4 min) to 150°C (hold 1 min) at
15°C/min. The split injection mode was used (1:2 split ratio, injection volume 1 μl). The mass
selective detector was operated in the EI ionisation mode (70 eV), at a scan mode from m/z 34 to
100 and SIM mode (m/z 56). The mass spectrometer was tuned by a maximum sensitivity in the
range 30-150 m/z. The ion source temperature was 230°C. The temperature of the GC–MS
transfer line was 200°C. The mass spectral identification of 1-butanol was carried out by
comparing obtained spectra to the NIST05 (National Institute of Standards and Technology,
Gaithersburg, MD) spectral library and to the mass spectrum of reference standards.
Chromatographic data acquisition and processing were conducted with an HP Chemstation Rev.
A 06. 01.
The amounts of 1-butanol and ethanol in the culture media were determined by gas
chromatography using a flame ionisation detector. The system consisted of a Shimadzu GC-17A
chromatograph equipped with an AOC-20i autosampler. An OmegaWax (Supelco) fused-silica
column (30 m, 0.25 mm i.d., 0.25 μm film thickness) was used. Helium was used as the carrier
gas at a constant flow of 1.5 ml/min. The column oven was programmed from 40°C (hold 4 min)
to 200°C (hold 1 min) at 30°C /min. The split injection mode was used (1:5 split ratio, injection
volume 1 μl). The temperature of the injector was 150°C. The detector was maintained at 250°C.
For acetic acid quantification, the system was supplied with a DB-FFAP (Agilent) column (30 m,
0.25 mm i.d., 0.25 μm film thickness). The column oven was programmed from 60°C (hold 3
min) to 230°C (hold 5 min) at 30°C/min. The split injection mode was used (1:20 split ratio,
injection volume 0.6 μl). The temperature of the injector was 220°C. Chromatographic data
acquisition and processing were carried out with Chrom&Spec software. The detection limits for
ethanol and 1-butanol were 10 mg/l and 0.1 mg/l, respectively.
The concentrations of organic acids, glucose and glycerol in the culture media were
measured by high-performance liquid chromatography using a Waters HPLC system (Waters).
For organic acid measurements, a reversed-phase column ReproSil-Pur C18-AQ (4 x 250 mm, 5
μm, Dr. Maisch) was used. Detection was performed at 210 nm. An aqueous solution of
phosphoric acid (100 mM) with acetonitrile and methanol (each at 0.5% (v/v)) was used as a
solvent, at a flow rate of 1.0 ml/min. For glucose and glycerol measurements, a Waters HPLC
system equipped with a refractive index Waters 2414 detector and a Spherisorb-NH2 column
(4.6 x 250 mm, 5 μm, Waters) was used. The mobile phase was used, which contained
acetonitrile/ethyl acetate/water in ratio of 76/4/20 (v/v/v) at a flow rate of 1.0 ml/min. Samples
were identified by comparing the retention times with those of corresponding standards.
Supplementary Table 2 Primer sequences
Primer name Sequence 5`→3`
P1
gtggccggaaggcgaagcggcatgcatttacgttgacgctcaagttagtataaaaaagctgaac
P2
gccataccgcgaaaggttttgcaccattcgatggtgtgaagcctgcttttttatactaagttgg
P3
agaaggggttgaatcgcaggc
P4
cgggaaacggtctgataagag
P5
tgcgacagatctgaattgtgagcgctcacaattggatc
P6
cttcgctcacaattccacacattataattgtgagcgctcacaatgtcaac
P7
gagtgcgttaagttcagcgacattagtaacagccatatgtatatctccttcgctcacaattccacacattata
P8
tttactaaaaaagtttaacattatcaggagagcattcgctcaagttagtataaaaaagctgaac
P9
ctagtaagatcttgaagcctgcttttttatactaagttgg
P10
cagtgagtgtgagcgcgag
P11
cttcgacgatacccatgcc
P12
aagatcatgtgggttatgtacgaacatccggaaactaagccacgttgtgtctcaaaatc
P13
gaacttgtagatacgtttacggatatccataaagcgtctgcctcgtgaagaaggtg
P14
tggcaaactccttcaaaccag
P15
ggtggtgacagcgatcattttc
P16
aagatcatgtgggttatgtacgaacatccggaaactcacttcgaaaagctggcgctg
P17
gaacttgtagatacgtttacggatatccataaagcgcagcgccagcttttcgaagtg
P18
aacgaaaagccccttacttgtaggaggtctgaccacatgtatatctccttcgctcacaattccacacattata
P19
aatgtttttacatccactacaaccatatcatcacaacgctcaagttagtataaaaaagctgaac
P20
gaagtacgggcaggtgctatg
P21
cagactgctgataaataagctcac
P22
ccagtcaaggtacagggtgtcgcctttgtaaagcatatgtatatctccttcgctcacaattccacacattata
P23
tacgaccagatcaccttgcggattcaggagactgaccgctcaagttagtataaaaaagctgaac
P24
cgtgatcagatcggcatttc
P25
gttcggcaatgccatcttcc
P26
agtacgtaccgcactgacgatgacacaatttttcatatgtatatctccttcgctcacaattccacacattata
P27
ttctgacggcacccctacaaacagaaggaatataaacgctcaagttagtataaaaaagctgaac
P28
catgggctactgcatcactg
P29
caggtcgatggcgctggt
Supplementary References
Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia
coli K-12 using PCR products. Proc Natl Acad Sci USA 97:6640-6645
Gulevich AYu, Skorokhodova AYu, Ermishev VYu, Krylov AA, Minaeva NI, Polonskaya ZM,
Zimenkov DV, Biryukova IV, Mashko SV (2009) A new method for the construction of
translationally coupled operons in a bacterial chromosome. Mol Biol (Mosk) 43:505-514
Katashkina JI, Skorokhodova AY, Zimenkov DV, Gulevich AY, Minaeva NI, Doroshenko VG,
Biryukova IV, Mashko SV (2005) Tuning the expression level of a gene located on a bacterial
chromosome. Mol Biol (Mosk) 39:719-726
Skorokhodova AYu, Zimenkov DV, Gilevich AYu, Minaeva NI, Biriukova IV, Mashko SV
(2006) Insertion of the symmetrical Olac-ideal between the "35" and "10" regions of the hybrid
Ptrc/Olac promoter leads to a significant increase in the efficiency of the LacI-driven repression.
Biotechnology in Russia 3:1-14