METHODS
Transmission Electron Microscopy
hiPSC-RPE were fixed in 2.5% glutaraldehyde, postfixed with 1% osmium tetroxide,
dehydrated with ascending concentrations of ethanol, and infiltrated by epoxy resin. Two
days after drying under the hood, ultrathin sections, about 60 nm thick, were obtained
with a microtome. hiPSC-RPE were visualized with a transmission electron microscope
(JEM-1400, JEOL).
Immunofluorescence Assays
The methods for immunocytochemistry and immunohistochemistry of hiPSCs and
hiPSC-RPE were described as previously. Antigens detected with primary antibodies
(spices, company, and dilution) were; Oct3/4 (mouse, Santa Cruz, 1/500), Nanog (rabbit,
ReproCELL, 1/500), SSEA-4 (mouse, Millipore, 1/300), Tra-1-60 (mouse, Millipore,
1/300), Pax6 (rabbit, Covance, 1/600), MiTF (mouse, Abcam, 1/1000), Bestrophin
(mouse, Abcam, 1/500), RPE65 (rabbit, 1/1000), ZO-1 (rabbit, Zymed, 1/100), Claudin1 (mouse, Invitrogen, 1/20), Claudin-3 (rabbit, Invitrogen, 1/200), Occludin (rabbit,
Invitrogen, 1/10), Na+/K+ ATPase (mouse, Millipore, 1/200) , Rhodopsin (mouse, Sigma,
1/1000), and human EMMPRIN (mouse, R&D, 1/80). The bound primary antibodies
were detected with secondary antibodies labeled with Alexa Fluor 488; goat anti-rabbit
IgG (Invitrogen, 1/500), or goat anti-mouse IgG (Invitrogen, 1/500), Alexa Fluor 546;
goat anti-rabbit IgG (Invitrogen, 1/1000), or goat anti-mouse IgG (Invitrogen, 1/1000),
and nuclei were stained with 4'6-diamindino-2-phenylindole (DAPI) (Molecular Probes,
1 µg/ml). Samples were imaged using a laser-scanning confocal microscope (FV1000-D,
Olympus). Two-photon excitation microscopy was performed using a confocal
microscope (A1R MP+, Nikon) with NIS-Elements software AR 4.2. Briefly, hiPSC-RPE
2w and 6w after they reached confluence were excited at λ = 730 nm and focused by a
CFI Plan Fluor 60XS Oil objective lens.
Fluorescence-activated cell sorting (FACS)
hiPSC-RPE were dissociated with 0.25% trypsin-EDTA (Invitrogen) and washed and
resuspended with 2% FBS in PBS. These cells incubated with APC-conjugated antihuman Mer (mouse, R&D) and isotype control antibodies (APC-IgG1 isotype control,
R&D) for 30 min at RT. After washing, 1 mg/ml propidium iodide was added (Dojindo,
1:1000), cells were passed through a cell strainer (BD), cell profiles were analyzed on
FACSCantoTM II (BD Biosciences), and the data were analyzed with FlowJo software
(Tree Star).
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted from hiPSCs and confluent hiPSC-RPE and human feral RPE
(Ronza) using RNeasy Plus Mini Kit® (QIAGEN) according to the manufacturer’s
instructions. The RNA concentration and quality were assessed with a NanoDrop 1000
spectrophotometer (NanoDrop Technoligies). The RNA was reversetranscribed using 20
μl reaction consisted of: 11 μl RNA (1000 ng) in DNase RNase Free water (QIAGEN), 1
μl 50 μM Oligo(dT)20 (Invitrogen), 1 μl 10 mM dNTP Mix (Invitrogen), 1 μl Rnase OUT
(20 U/μl; Invitrogen), SuperScriptTM III Reverse Transcriptase (4 μl 5×First-Standard
Buffer, 1 μl 0.1 M DTT, 1 μl SuperScript III 200 U/μl;Invitrogen) and the cDNA synthesis
was performed as follows:15 min at 25°C, 60 min at 50°C,and 15 min at 70°C. PCR
reactions were performed using Ex Taq® DNA polymerase (Takara Bio). Thermal cycling
conditions were performed as follows: one cycle at 94°C for 120 sec; 30 cycles at 94°C
for 30 sec, 57°C for 30 sec, and 72°C for 60 sec; one cycle at 72°C for 60 sec. Following
forward and reverse (FP and RP) primer sequences used to amplify the four RPE specific
genes as below.
RPE65: FP: TCCCCAATACAACTGCCACT; RP: CCTTGGCATTCAGAATCAGG
CRALBP:
FP:
GAGGGTGCAAGAGAAGGACA;
RP:
TGCAGAAGCCATTGATTTGA
MERTK: FP: TCCTTGGCCATCAGAAAAAG; RP: CATTTGGGTGGCTGAAGTCT
Bestrophin1:
FP:
TAGAACCATCAGCGCCGTC;
RP:
TGAGTGTAGTGTGTATGTTGG
GAPDH: FP: ACCACAGTCCATGCCATCAC; RP: TCCACCACCCTGTTGCTGTA
Transepithelial electrical resistance (TER)
TER was performed according to the manufacturer’s instructions of the electrical
resistance system (Millicell®, Millipore). Briefly, we connected test electrode of electrical
resistance system (Millicell®; Millipore) into input port on the meter and confirmed that
the meter displayed 1000 Ω. The electrode was rinsed with 70% ethanol for 15 min and
SFRM for 15 min. Measurement was within 3 min after taking out from the incubator to
prevent reducing temperature. Net TER (Ωcm2) was calculated by subtracting the value
of collagen gel only in the insert as a blank from the experimental value and multiplying
by the area of the insert membrane.
Enzyme linked immunosorbent assay (ELISA) for vascular endothelial growth
factor (VEGF) and pigment epithelium-derived factor (PEDF)
The culture medium from confluent hiPSC-RPE was collected 24 hr after the medium
was changed. Secretion levels were measured by the human VEGF-ELISA Kit
(eBioscience) for VEGF and human PEDF-ELISA Kit (BioVender) for PEDF, following
the manufacturers' instructions.
Measurement of melanin
hiPSC-RPE in 12-well dish was collected and dissolved by 150 μl solution consisted of
(1% SDS, 0.05 mM EDTA, 10 mM Tris-HCl, and 5 mg/ml Proteinase K) at 45°C
overnight. The solution was added 25 μl of 500 mM sodium carbonate buffer and 5 μl of
30% hydrogen peroxide solution at 80°C for 30 min. The solution was centrifuged at
15,000 rpm for 10 min after addition of 20 μl of chloroform/ methanol [2:1]. The
supernatant (150 μl) was collected and excited at 405 and 570 nm wavelengths. Subtract
readings at 570 nm from the readings at 405 nm. Standard curve was used Melanin (MP
Biomedicals).
Differentiation of hiPSCs into RPE
Using the previously described method8, we induced RPE from hiPSCs that expressed
the pluripotency markers (OCT3/4, Nanog, Tra-1-60, and SSEA4) and formed teratomas.
Pigmented colonies with the characteristic RPE cobblestone appearance were confirmed
within 3 weeks after initiating differentiation. To obtain a homogeneous population of
these cells, we manually transferred and cultured the pigmented colonies until they
became confluent (see Supplementary Figures S1A-E and Methods).
Animal experiments
The care and maintenance of all animal conformed to the ARVO Statement for the Use
of Animals in Ophthalmic and Vision Research. All animal experiments were approved
by Kawasaki Medical School Animal Experiment Committee. The animals were housed
in rooms under standard laboratory conditions (18–23°C, 40%–65% humidity, 12 hr.
light/12 hr. dark cycle), with food and water available ad libitum. Animals were
anesthetized with a mixture of ketamine and xylazine, and their pupils dilated with 0.5%
tropicamide and 0.5% phenylephrine hydrochloride.
Transplantation of hiPSC-RPE into RCS rats
Pink-eyed dystrophic RCS (Jcl-rdy/rdy, p-) rats were purchased from CLEA Japan. All
rats were administered 210 mg/l cyclosporine to the drinking water two days prior to the
injection, and consequently no signs of rejection were observed around the transplantation
sites.
To examine the suitable temperature for preservation of hiPSC-RPE cell suspension until
transplantation, hiPSC-RPE cell suspension including 1 × 105 cells in 2 µl DMEM/F12
medium was preserved in three different temperature (on ice, RT; room temperature, and
37 °C) and measured percent viable cells sequentially (3, 6, and 12 hr after preparation).
For transplantation, 2 µl hiPSC-RPE cell suspension was injected into the subretinal
space of the right eye of 3-week-old RCS rats (n = 10) using a 33-gauge needle with a
Hamilton syringe through a small scleral incision with a 30-gauge disposable needle. An
equivalent medium was injected subretially as sham surgery in five contralateral eyes.
The other five contralateral eyes were classified as no treatment. Nine weeks after
transplantation (i.e., at 12 weeks age), the eyes were processed for histological evaluation.
FIGURE LEGENDS
Supplementary Figure 1. Generation of hiPSC-RPE from hiPSCs
(A) Phase-contrast image and immunostaining for the pluripotency markers OCT3/4,
NANOG, SSEA4, and TRA-1-60 of hiPSCs. Scale bar, 100 μm.
(B) Left panel shows a low-power image of an immunodeficient SCID mouse testis 1.5
months after injection. Injection of hiPSCs induced teratoma formation, and no teratoma
formation was observed in the animals that underwent sham surgery. Right panels show
histological sections of teratomas derived from hiPSCs.
(C) Low-power image of a 6-cm dish containing hiPSCs three weeks after initiating
differentiation. Some cells formed pigmented colonies with a typical RPE cobblestone
appearance.
(D) Phase-contrast image of transferred pigmented cells cultured until confluence. Scale
bar, 100 μm.
(E) Low-power (left panel) and phase-contrast (right panel) images of a 12-well
TranswellTM plate containing hiPSC-RPE four weeks after seeding. Scale bar, 100 μm.
Supplementary Figure 2. Characterization of hiPSC-RPE
(A) Transmission electron microscopy image of abundant apical microvilli (middle panel),
adherens, and tight junctions (right panel) in the pigmented cells (left panel).
(B) RT-PCR analysis of typical RPE markers (BEST1, MERTK, RPE65, and CRALBP)
in hiPSCs, hiPSC-RPE, and human fetal RPE (RONZA) as a control. hiPSC-RPE and
human fetal RPE expressed typical RPE markers. The left lane is the 100-bp DNA ladder,
and the right lane is the 20-bp DNA ladder. (C) Mean fluorescence intensity of human
Mer antigens in hiPSC-RPE. The red histograms represent isotype control antibodies.
hiPSC-RPE expressed high levels of Mer.
(D) Immunostaining for typical RPE markers (PAX6, MITF, BEST1, and RPE65; scale
bar, 50 μm) and cellular adhesion markers (ZO-1, Claudin-1, Claudin-3, Occludin, and
Na/K ATPase; scale bar, 20 μm) in the pigmented cells.
(E) Percent viability of hiPSC-RPE at three different temperatures (on ice, room
temperature, and 37°C) tested sequentially. Room temperature (green line) consistently
yielded the best viability of the cells among the three tested temperatures for up to 12
hours.
(F) Confocal images of a RCS rat eye and transplanted cells were positive for anti-human
EMMPRIN. Upper panel shows an EMMPRIN- and DAPI-stained image of hiPSC-RPE
transplantation in a 12-week-old RCS rat, showing preservation of the ONL above the
graft (green). Scale bar, 100 μm. Lower panels show immunostaining for rhodopsin (red)
and EMMPRIN (green) in a transplanted eye section, showing that the ONL and inner
segments above the graft were well preserved. Scale bar, 20 μm.
(G) H&E sections of 12-week-old RCS rats (non-transplantation, sham surgery, and
transplantation).
(H) H&E analyses of 12-week-old RCS rats (non-transplantation, sham surgery, and
transplantation; n = 5 for each). ONL thickness and fRT in the transplanted eyes (ONL:
26.0 ± 1.2; fRT: 128.1 ± 1.7 µm) were significantly greater than those in both the shamsurgery (ONL: 7.7 ± 0.5; fRT: 96.9 ± 2.0 µm) and non-transplanted (ONL: 6.5 ± 0.5; fRT:
79.2 ± 1.0 µm) eyes.
Supplementary Figure 3. Characterization of hiPSC-RPE
(left panels) RT-PCR analysis of typical RPE markers (BEST1, MERTK, RPE65, and
CRALBP) in hiPSC-RPE in two different media: pre- and post-confluent medium (2w
and 6w after they reached confluence). (right panels) Immunostaining for proliferation
markers (Ki67; scale bar, 50 μm) in hiPSC-RPE (before they reached confluence in preconfluent medium, immediately after they reached confluence in pre-confluent medium,
6w after they reached confluence in pre-confluent medium, 6w after they reached
confluence in post-confluent medium).
Supplementary Figure 4. Characterization of hiPSC-RPE
(A) (left panel) The amount of melanin in hiPSC-RPE (454E2, n = 1 for each) increased
in a time-dependent manner (0w 56.3 μg/well, 2w 132.6 μg/well, 4w 231.4 μg/well, 6w
after they reached confluence 260.6μg/well). (right panel) The amount of melanin in
hiPSC-RPE (454E2, n = 1 for each) increased as the light transmittance of hiPSC-RPE
decreased (0w 56.3 μg/well 75.0 %, 2w 132.6 μg/well 58.5 %, 4w 231.4 μg/well 44.0 %,
6w after they reached confluence 260.6μg/well 34.3 %). (B) (upper panels)
Immunostaining for the functional RPE marker (Ezrin; scale bar, 10 μm) in hiPSC-RPE
(2w and 6w after they reached confluence). (lower panels) The autofluorescence in
hiPSC-RPE 2w and 6w after they reached confluence didn’t show significant differences.