Electronic Supplementary Material 1
Materials and Methods
Animals and crosses: In vitro cross-fertilizations between X. laevis, X. muelleri and X. borealis
were conducted 10 hr after injecting females with 600-700 IU of chorulon (hCG) resuspended in
sterile water. Eggs were collected to Petri dishes by gentle squeezing, while sperm was obtained
by collecting testes from males into ice-cold 1x MMR; fertilization was achieved by adding a
few drops of the sperm solution to the eggs. The fertilized eggs were then washed and
submerged in 0.1x MMR for 24 hrs, until embryos were ready to be transferred to containers
with room temperature water. A total of 180 individuals were used for genetic analyses
(pyrosequencing, NGS, Sanger sequencing, ddPCR, and FISH) from all species/crosses,
including 6-8 years old adults, froglets, tadpoles, blastulas, gastrulas, neurulas, and epithelial
primary cells isolated from adult kidneys.
Sex-reversal experiment: Portions (80-200 tadpoles) of two F1 clutches from a X. laevis x X.
muelleri cross were subjected to sex-reversal treatment [1]. Tadpoles were raised in 54 L of dechlorinated water and sex-reversed females were produced by adding estradiol (50 μg/L) to the
water daily starting in the third week of development (Nieuwkoop and Faber tadpole stages 5255) until metamorphosis was complete. To distinguish ZW vs. ZZ genotypes in sex-reversed
individuals we used a W chromosome marker [2, 3]. DNA was extracted from toe clips from
adult sex-reversed frogs with the QIAGEN DNAeasy kit (Valencia, California, USA). Multiplex
PCR amplification with W and Z chromosome specific primers was performed at 94°C for 5
minutes, followed by 30 cycles of 94°C denaturation, 55°C annealing, and 72°C extension
(Promega Taq polymerase; Madison, Wisconsin, USA) providing unambiguous genotypic sex
assignment of ZW or ZZ individuals[1].
Cell culture: All cell lines were maintained at 23oC, on 70% L-15 medium (BioWhittaker) with
glutamine, supplemented with 10%FBS (Hyclone), Pennicilin/ Streptamycin 100ug/ml (Caisson
Laboratories Inc.). We cultured cells following standard sterile techniques, passaging cells and
changing to fresh medium every 3-5 days. A6- Xenopus laevis kidney cells were purchased from
ATCC. XTC-2 cell lines were established by digestion with 0.25% trypsin as described in
Pudney (et.al.PMID). Briefly, tadpoles with 4 legs or small froglets were kept for 2 days in
sterile conditions in water containing mix of antibiotics (100ug/ml penicillin,100ug/ml
gentamycin, 0.5ug/ml amphotericinB). Animals were euthanized in sterile tricaine methane
sulfonate solution (MS222). After removing limbs, heads, skin and internal organs, the
remaining carcasses were cut up into smaller pieces, washed few times with PBS and placed in
small sterile beakers with magnetic stirrers. The tissue was digested with 5 ml of 0.25% trypsin
(Sigma Aldrich) for 10 min. Initial supernatant was discarded and replaced with fresh trypsin.
Digestions were repeated 3-4 times, 10min each and all collected cell suspensions stored at 4oC,
till the process was finished. The cells were filtered through the sterile gauze, collected by
centrifuging at 800g for 10min, washed once with PBS, resuspended and maintained in standard
L-15 medium. The cell lines from adult animals were obtained by culturing dissected whole
kidneys and hearts, in standard 70% L-15 medium, supplemented with 0.25ug/ml amphotericinB
(MP Biomedical) and 50ug/ml gentamycin (Amresco). We also used spleen and kidney cells
from squashes in 1XPBS for slide preparation.
Fluorescent detection of nucleoli: The cells were washed 1x with PBS, dropped onto a slide and
dried until all attached to the surface, then fixed with 4% paraformaldehyde/1X PBS for 10min.
After 5 min permeabilization in 0.05% triton/1X PBS, the cells were dehydrated with 70%
ETOH for 5 min and air dried. We blocked the cells for 1hr in 10% fetal bovine serum in
1XPBS, incubated 1-2 hr with anti-AH6-s and anti-p7-1A4-s (DSHB) primary antibody in
blocking buffer. The length of the incubation and antibody dilution varied by lot, and was
established each time. We used Goat anti-Mouse IgG(H+L)DylightTM488 (Thermo Scientific)
conjugated secondary antibody. The cells were counterstained for nuclei with either DAPI or
NucBlueR Fixed Cell Stain ReadyProbe TM (Molecular ProbesR).
Fluorescence in situ hybridization: A 592 nt long probe was designed to detect identical
sequence of 18SrDNA, present in all three Xenopus species. Fragments amplified using
AccuPrimeTM Pfx DNA Polymerase (InvitrogenTM) with forward
CTGGTTGATCCTGCCAGTAGCA, and reverse CACCAGACTTGCCCTCCAAT primers
were cloned into pCRR4 Blunt-TOPOR vector. Cloned sequences were sequenced and checked
for consistency, and then used as a matrix for probe synthesis. We used PCR DIG Synthesis kit
from Roche for probe preparation and followed the manufacturer’s protocol. Cells, cultured for 2
days after passage, were harvested by trypsinization and washed once with 1X PBS. Pellet was
resuspended in 0.075M KCl hypotonic solution for 10min at 37oC to swell the cells. After
washing with 1X PBS, cells were dropped onto the slides, air dried until attached, then fixed for
15 minutes with 4% paraformaldehyde/ 5%acetic acid/ 0.9% NaCl, followed by 5 min wash in
PBS, and 5min permeabilization in 0.05% triton/1XPBS. Slides were fixed for 5min at 4oC in
70% ETOH, dehydrated in series of 3 min incubations in 70, 95, 100% ETOH at RT, dewaxed
for 2min in xylene, then rehydrated in 100, 90 and 70% ETOH 2 min each time. After 15 min
37oC digestion with Rnase A (10ug/ml), followed by 15min 37oC 0.1% pepsin /0.1N HCl
digestion, slides were washed with PBS, post-fixed for 10min with 1% formaldehyde, and
washed again 5min with PBS. DIG-labeled probe was diluted in hybridization solution (60%
deionized formamide, 300mM sodium citrate, 10mM EDTA, 25mM NaH2PO4(pH 7.4), 5%
dextran sulfate, 250ng/ul sheared salmon sperm). Final concentration of the probe was
determined empirically. Both, slides covered with hybridization buffer and diluted probe were
denatured for 2 min at 74oC. We performed overnight hybridization at 37oC in the moist
chamber. Posthybridization washes consisted of series: 3 times at RT 5 min, 1 time at 37oC in
60% deionized formamide/ 300mM NaCl/ 30mM sodium citrate. After 5 min wash in PBS, we
blocked the slides for 1 hr in blocking buffer (2.5% BSA/1xPBS/ 0.1% TWEEN-20), and
incubated with Anti-digioxigenin-Fluorescein antibody (1:250 dilution in blocking buffer) for 45
min. Excess of bound antibody was removed by 2x 5min washes in 1XPBS/0.1% TWEEN-20,
then nuclei were counterstained with NucBlue R Fixed Cell Stain ReadyProbeTM. Coverslips
were mounted onto the slides with the drop of Prolong R Gold Anti Fade Reagent TM
(InvitrogenTM).
Wide-field microscopy: The pictures were taken using Nikon Eclipse TE2000-U inverted
microscope, equipped with CoolSnap HQ2 monochrome 1394x 1040 pixels camera, NIS
Elements imaging software, and analyzed in ImageJ Software.
Ion Torrent Sequencing of rRNA: Total RNA (200 ng) was isolated from toes of adult female
X. laevis, X. muelleri, and F1 hybrid from the X. laevis x X. muelleri cross. cDNA libraries were
constructed with the Ion Total RNA-Seq Kit v2.0 (Life Technologies), using manufacturer’s
standard protocols with the modification that no rRNA depletion was applied, and sequenced
with the Personal Genome Machine System (Life Technologies). A total of 304,228, 456,705,
and 561,878 reads were obtained from the libraries, respectively, with the average read length of
98 bp. We BLASTed NCBI’s rRNA sequences against obtained fasta files and species-specific
SNPs were parsed out for validation with Sanger sequencing of genomic DNA from multiple
(>10 per species) individuals, including X. borealis. Gene- and species-unique markers are listed
in the table below.
Mismatches
Location
Position
Ref
XL
XM
XB
Flanking Sequences
18S
1707
C
C
A
C
ttgggatcgagctggcggtccgccgCGaggcggctaccgcctgtcccagccc
18S
1708
G
G
A
A
ttgggatcgagctggcggtccgccgCGaggcggctaccgcctgtcccagccc
18S
2752
C
C
A
A
tcggatcggccccgccggggtcggcCacggccctggcggagcgccgagaaga
5.8S
3551
C
C
T
n/a
tgcggccccgggttcctcccggggcCacgcctgtctgagggtcgctccgacg
28S
3855
C
C
T
T
cacgactcagacctcagatcagacgCggcgacccgctgaatttaagcatatt
28S
4703
G
G
A
A
gggcggactgcccccagtgcgccccGtccgcgccgcgccgccgaggcgggag
28S
4970
C
C
T
n/a
gccaccaccggcccgtctcgcccgcCccgtcggggggtgggcgtgagcgcgcg
28S
5929
G
G
A
A
ggggggcgggggcgtccagtgcggcGacgcgaccgatcccggagaagccgggg
28S
6861
G
G
A
A
ccacagccaagggaacgggcttggcGgaatcagcggggaaagaagaccctgtt
28S
7729
G
G
C
n/a
gcgccccccccggggggcgccggcgGgcagagccgctcgcctcgggaccggag
Reference (Ref) downloaded from http://www.ncbi.nlm.nih.gov/nuccore/X02995.1;
n/a – not tested
Illumina RNA-sequencing: A total of eight cDNA libraries were made of Nieuwkoop-Faber
stage 40 X. laevis, X. muelleri, F1 from X. laevis x X. muelleri, and F1 from the reciprocal cross
X. muelleri x X. laevis (two libraries per group). Using TruSeq RNA sample preparation kit
(Illumina, FC-122-1001/1002), mRNA from 1 µg of total RNA with RIN ≥ 8.0 was converted
into a library of template molecules suitable for subsequent cluster generation and sequencing
with Illumina HiSeq 1000. The libraries generated were validated using Agilent 2100
Bioanalyzer and quantitated using Quant-iT dsDNA HS Kit (Invitrogen) and qPCR. Individually
indexed cDNA libraries were barcoded, pooled, clustered onto a flow cell using Illumina’s
TruSeq SR Cluster Kit v3 (GD-401-3001), and sequenced 101 cycles using TruSeq SBS Kit -HS
(FC-401-1002) on HiSeq 1000 over two lanes. Adapter sequences were removed using cutadapt
software (version 1.1; http://code.google.com/p/cutadapt) with quality cut-off of 20 and
minimum read length of 15 nt. For X. laevis and X. muelleri, Oases (version 0.2.08) [4] with a
merged option for two libraries was used for the de novo RNA-Seq assembly with different k-
mer lengths ranging from 21 to 31. Then, the trimmed reads were mapped to the assembled
transcripts of X. laevis and X. muelleri using Bowtie (version 0.12.7)[5] with maximum
mismatches of 3, which is denoted as max mismatch. This mapping was performed for each
library. In total, 775,409 and 422,777 unique transcripts were created for X. laevis and X.
muelleri, respectively. The maximum length of transcripts was 41,507 and 35,641, and the mean
length of transcripts was 824 and 831for X. laevis and X. muelleri, respectively. Using our script,
the frequency of reads in each library that were mapped to each transcript in X. laevis and X.
muelleri was counted from SAM files. DESeq (version 1.14.0) [6] was used for differential
expression analysis between two groups, each having two replicates, against X. laevis and X.
muelleri transcriptome assemblies. Since the results were almost identical regardless of the
parental reference used, only results from the X. laevis reference are presented. Blast2GO
(www.blast2go.com) was used for functional annotations.
Alelle-biased RNA-seq analysis: To investigate allele-biased expression in F1 hybrid generation,
the trimmed reads for the two F1s (i.e. F1 from X. laevis x X. muelleri, and F1 from the reciprocal
cross X. muelleri x X. laevis (hereafter, F1rec)) were mapped to the assembled transcripts of X.
laevis and X. muelleri using Bowtie with no mismatch, which is denoted as perfect match, and
the frequency of reads that were mapped to each transcript in X. laevis and X. muelleri was
counted from SAM files. For each F1 and F1rec, to match a transcript of X. laevis to the
corresponding transcript in X. muelleri, it was assumed that if a specific read is mapped to a
transcript (TL) in X. laevis and to a transcript (TM) in X. muelleri, the two transcripts (TL and
TM) are matched. To find all possible pairs of matched transcripts in X. laevis and X. muelleri, a
script was developed. As a result, for all pairs of matched transcripts, the number of reads
mapped with the two different methods (max mismatch and perfect match) was identified. For a
pair of matched transcripts, the ratio of the frequency with perfect match to the frequency with
max mismatch was computed for each X. laevis and X. muelleri, and the difference of the two
ratios was computed. This was performed for all pairs of matched transcripts in each F1 and
F1rec. After sorting the difference in descending order, the sequences for the top 100 allelebiased transcripts were extracted from X. laevis and X. muelleri for each F1 and F1rec. Then,
these sequences were fed into Blast2GO (www.blast2go.com) and the proteins for the sequences
were compared for the four outputs (F1 mapped to X. laevis, F1rec mapped to X. laevis, F1
mapped to X. muelleri, and F1rec mapped to X. muelleri).
SOLiD sequencing of snoRNAs: Total RNA was obtained from the ground testes of freshly
euthanized X. laevis, X. muelleri and X. laevis x X. muelleri hybrids using Ambion RNA
extraction kits (IACUC protocol number A08.002). To obtain 40 nt RNAs, the samples were
fractionated using an Ambion flashPAGE fractionator. Libraries of small RNA cDNAs were
constructed and sequenced using ABI’s SOLiD sequencing technology based off its 35nucleotide array, as described elsewhere [7] . We extracted snoRNA sequences for Xenopus
tropicalis from snoRNA Orthological Gene Database [8]. Three libraries were mapped to the
snoRNA sequences using Bowtie [5]. Using our script, the frequency of reads that were mapped
to each snoRNA was counted from SAM files. For differential expression analysis between two
groups without replicate, the Bioconductor edgeR package [9] (version 3.4.2) was used.
snoRNAs with species-unique sequence variants were identified, comparing the variant call
format (VCF) files that resulted from a task for the SNP calling using SAMtools (version 0.1.18)
[10].
Allele-specific pyrosequencing: Since F1 hybrids are heterozygous for parental species-unique
alleles, we could quantify allele-specific expression levels, as well as estimate proportions of the
alleles in the genome. PyroMark OneStep RT-PCR Kit (Qiagen) was used for making cDNA,
and PyroMark PCR Kit (Qiagen) was used for amplification. DNase I treatment to remove any
possible contaminating DNA was applied to RNA samples, followed by the reverse transcription
of the RNA. PSQ H96A (Qiagen) Pyrosequencing system was used for allele-specific assays
following the manufacturer’s instructions. Briefly 1 ng of sample DNA was used for PCR
amplification. PCR was performed using 10X PCR buffer (Qiagen) at 3.0 mM MgCl2, 200 M of
each dNTP, 0.2 µM each of the forward and reverse primers, and 0.75U of HotStar DNA
polymerase (Qiagen), per 30 μl reaction. PCR cycling conditions were: 94ºC 15 min; 45 cycles
of 94ºC 30 s; 60ºC 30 s; 72ºC 30 s; 72ºC 5 min. One of the PCR primer pairs was biotinylated to
convert the PCR product to single-stranded DNA sequencing templates using streptavidin beads
and the PyroMark Q96 Vacuum Workstation. 10 µl of the PCR products were bound to
streptavidin beads and the single strand containing the biotinylated primer was isolated and
combined with a specific sequencing primer. The genotypes of each sample were analyzed using
PSQ software (Qiagen). Negative controls were used on all plates, including untreated RNA with
no reverse transcription, and reverse-transcribed RNA with no DNase I treatment.
Droplet-digital PCR and 45S copy number estimation: Copy number of 18S rDNA gene was
validated using mannosyl-oligosaccharide glucosidase – gene (mogs), present in only one copy
in Xenopus genomes [11], as a control. The fragment of mogs gene sequence was amplified from
genomic DNA of X. laevis, X.borealis, and X.muelleri, with primers: mogs forward:
CTGAAGATGAGCGGCATGTGGATCTG, mogs reverse: CAGCCATGATTAGTACCAC,
and cloned into pCRR4 Blunt-TOPOR vector. We targeted the consensus region to design primers
and probes. Genomic DNA was extracted with Gentra R Puregene R kit (Qiagen) according to the
manufacturer’s protocol. DNA was digested with EcoR1 and PstI enzymes (New England
Biolabs), selected upon the criterion of not having restriction sites inside of all the amplicons.
RNA was extracted with Trizol R (Life Technologies) and 50ng total per 20ul reaction was
reverse transcribed with gene specific primer, using Quantitect R Reverse Transcription Kit
(Qiagen) and according to the product protocol. Digital Droplet PCR reactions of total 20ul were
assembled using 2X ddPCR supermix for probes (Biorad), 250nM final concentration of
primer/probe mix and 10ng total for mogs gene, and 1ng of digested DNA for 18S rDNA gene
copy number estimations as well as for SNP quantification. For expression quantification we
used only 0.001ng total of cDNA. The primer and probe sequences for mogs gene were:
CTCCATGTGGCTGTACAAGTA for forward, CTTTGTACCTGCAACGTAACAC for reverse
primer, and probe AACTGCCAGATAGTTCATGTTAATCCA. 18S rDNA region was
amplified with primers CAAGACGAACCAAAGCGAA for forward,
TCGGAACTACGACGGTATCT for reverse, and probe sequence
CGAAAGTCGGAGGTTCGAAGAC. Mogs probe was 5’ labeled with HEX, 18SrDNA with
FAM, and both 3’ labeled with BHQ1. Species-specific SNP quantification of 18SrDNA was
performed with forward- CCGGGACACTCAGTCAAGAG, reverseCTATTGGAGGGCAAGTCTGG primers. We utilized LNA technology (Locked Nucleic Acid)
to improve annealing of the probe to the target. Sequences with LNA modified nucleotides,
depicted as +, were as follows: 18S Probe CG: 5’[HEX]TAGCTCGCCT(+C)(+G)CGGC[BHQ1], 18S Probe TT: 5’-
[HEX]TAG(+C)TCGCCTT(+T)CGGCGG[BHQ1],18S Probe TG: 5’[HEX]TAGCTCGCCT(+T)GCGGCG[BHQ1]. Same set of nucleotides to validate 28S rDNA
SNP we used forward primer- TAGCGAAACCACAGCCAAG, reverseTCCCACTTATCCTACACCTCTC, probe G- [HEX]GAACGGGCTTGGCGGAATCAG
[BHQ1] and probe A- [HEX]GGAACGGGCTTGGCAGAATCAG [BHQ1]. Reactions for SNP
detection were multiplexed. Droplets were generated on QX100 Droplet Generator with 70ul of
droplet generator oil. PCR reaction was performed as follows: 95oC for 10minutes for enzyme
activation, followed by 40 cycles of two step reactions 94oC 30 second for denaturation, and
58oC for 1 minute for annealing, then 1cycle of 10 minute held at 98oC, and final hold at 12oC.
Both, concentrations of primers and probes and annealing temperatures were optimized to obtain
clear difference between positive and negative droplets. Number of positive and negative
droplets was quantified on QX100 Droplet Reader (Biorad). All sets of reactions included
samples of all three species as controls, but non-specific signaling was found to be negligible.
Supplementary References
[1] Malone, J.H. & Michalak, P. 2008 Physiological sex predicts hybrid sterility regardless of
genotype. Science 319, 59.
[2] Yoshimoto, S., Okada, E., Oishi, T., Numagami, R., Umemoto, H., Tamura, K., Kanda, H.,
Shiba, T., Takamatsu, N. & Ito, M. 2006 Expression and promoter analysis of Xenopus DMRT1
and functional characterization of the transactivation property of its protein. Dev Growth Differ
48, 597-603.
[3] Yoshimoto, S., Okada, E., Umemoto, H., Tamura, K., Uno, Y., Nishida-Umehara, C.,
Matsuda, Y., Takamatsu, N., Shiba, T. & Ito, M. 2008 A W-linked DM-domain gene, DM-W,
participates in primary ovary development in Xenopus laevis. Proc Natl Acad Sci U S A 105,
2469-2474.
[4] Schulz, M.H., Zerbino, D.R., Vingron, M. & Birney, E. 2012 Oases: robust de novo RNAseq assembly across the dynamic range of expression levels. Bioinformatics 28, 1086-1092.
[5] Langmead, B., Trapnell, C., Pop, M. & Salzberg, S.L. 2009 Ultrafast and memory-efficient
alignment of short DNA sequences to the human genome. Genome Biol 10, R25.
[6] Anders, S. & Huber, W. 2010 Differential expression analysis for sequence count data.
Genome Biol 11, R106.
[7] Madison-Villar, M.J. & Michalak, P. 2011 Misexpression of testicular microRNA in sterile
Xenopus hybrids points to tetrapod-specific microRNAs associated with male fertility. J Mol
Evol 73, 316-324.
[8] Yoshihama, M., Nakao, A. & Kenmochi, N. 2013 snOPY: a small nucleolar RNA
orthological gene database. BMC Res Notes 6, 426.
[9] Robinson, M.D., McCarthy, D.J. & Smyth, G.K. 2010 edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140.
[10] Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis,
G. & Durbin, R. 2009 The Sequence Alignment/Map format and SAMtools. Bioinformatics 25,
2078-2079.
[11] Bewick, A.J., Anderson, D.W. & Evans, B.J. 2011 Evolution of the closely related, sexrelated genes DM-W and DMRT1 in African clawed frogs (Xenopus). Evolution 65, 698-712.