Table S1. Bacterial strains and plasmids Strain Relevant genotype Origin or construction MG1655 Parental strain Laboratory collection DV1093 MVA+ (Vinella et al., 2009) DV206 lacIpoZΔ(Mlu) (Vinella et al., 2000) DV1389 lacIpoZΔ(Mlu) PiscR::lacZ DV1301 lacIpoZΔ(Mlu) PhmpA::lacZ Lysogen of DV206 (This study) DV1367 lacIpoZΔ(Mlu) PhmpA(short))::lacZ Lysogen of DV206 (This study) DV1479 lacIpoZΔ(Mlu) PiscR::lacZ MVA+ DV1307 lacIpoZΔ(Mlu) PhmpA::lacZ MVA+ DV1478 lacIpoZΔ(Mlu) PiscR::lacZ ∆iscR Lysogen of DV206. As DV781 (Trotter et al., 2009) DV1389 + P1/ DV1093, selection LB Kan DV1301 + P1/ DV1093, selection LB Kan DV1389 + P1/ JW2515, selection LB Kan then cured with pCP20 DV1389 + P1/ JW1674 (Baba et DV1471 al., 2006), selection LB Kan then lacIpoZΔ(Mlu) PiscR::lacZ ∆sufA cured with pCP20 DV1389 + P1/ DV595 (Vinella et DV1473 al., 2009), selection LB Can then lacIpoZΔ(Mlu) PiscR::lacZ ∆suf cured with pCP20 DV1389 + P1/ DV698 (Vinella et DV1474 al., 2009), selection LB Can then lacIpoZΔ(Mlu) PiscR::lacZ ∆iscA cured with pCP20 DV1389 + P1/ DV597 (Vinella et DV1475 lacIpoZΔ(Mlu) PiscR::lacZ ∆iscUA al., 2009), selection LB Can then cured with pCP20 DV1480 DV1483 DV1135 DV1492 lacIpoZΔ(Mlu) PiscR::lacZ ∆sufA DV1471 + P1/ DV1093, selection MVA+ LB Kan lacIpoZΔ(Mlu) PiscR::lacZ ∆iscA MVA+ lacIpoZΔ(Mlu) PiscR::lacZ MVA+ ∆erpA::cat lacIpoZΔ(Mlu) PiscR::lacZ DV1474 + P1/ DV1093, selection LB Kan DV1479 + P1/ DV1094 (Vinella et al., 2009), selection LB Can on LB + mevalonate plates in anaerobiosis MVA+ ∆sufA DV1471 + P1/ DV698 (Vinella et 1 al., 2009), selection LB Can on LB ∆iscA + mevalonate plates in anaerobiosis DV1494 DV1336 lacIpoZΔ(Mlu) PiscR::lacZ MVA+ ∆sufA ∆iscA∆erpA::cat DV1492 + P1/ DV1094 (Vinella et al., 2009), selection LB Can on LB + mevalonate plates in anaerobiosis DV1301 + P1/ JW4136, selection lacIpoZΔ(Mlu) PhmpA::lacZ ∆nsrR LB Kan then cured with pCP20 DV1301 + P1/ JW1674 (Baba et DV1302 al., 2006), selection LB Kan then lacIpoZΔ(Mlu) PhmpA::lacZ ∆sufA cured with pCP20 DV1301 + P1/ DV595 (Vinella et DV1306 al., 2009), selection LB Can then lacIpoZΔ(Mlu) PhmpA::lacZ ∆suf cured with pCP20 DV1301 + P1/ DV698 (Vinella et DV1563 al., 2009), selection LB Can then lacIpoZΔ(Mlu) PhmpA::lacZ ∆iscA cured with pCP20 DV1301 + P1/ DV597 (Vinella et DV1564 lacIpoZΔ(Mlu) PhmpA::lacZ ∆iscUA al., 2009), selection LB Can then cured with pCP20 DV1308 DV1570 DV1326 DV1576 DV1583 pBAD24 pBADI pLAI-A lacIpoZΔ(Mlu) PhmpA::lacZ ∆sufA DV1302 + P1/ DV1093, selection MVA+ lacIpoZΔ(Mlu) LB Kan PhmpA::lacZ ∆iscA DV1563 + P1/ DV1093, selection MVA+ LB Kan lacIpoZΔ(Mlu)PhmpA::lacZ MVA+ ∆erpA::cat lacIpoZΔ(Mlu) PhmpA::lacZ MVA+ PhmpA::lacZ MVA+ Cloning vector, AmpR Cloning vector, pBAD24 derivative Para::iscA, AmpR DV1308 + P1/ DV698 (Vinella et al., 2009), selection LB Can on LB + mevalonate plates in anaerobiosis ∆iscA ∆erpA::cat ∆sufA (AmpR) al., 2009), selection LB Can on LB + mevalonate plates in anaerobiosis ∆sufA ∆iscA lacIpoZΔ(Mlu) DV1307 + P1/ DV1094(Vinella et DV1570 + P1/ DV1094 (Vinella et al., 2009), selection LB Can on LB + mevalonate plates in anaerobiosis (Guzman et al., 1995) (Py et al., 1999) (Vinella et al., 2009) 2 pLAS-A Para::sufA, AmpR (Vinella et al., 2009) pLAE-A Para::erpA, AmpR (Vinella et al., 2009) pLAOS Para::sufABCDSE, AmpR This study pLAOa Para::sufBCDSE, AmpR This study pLAOHyb Para::iscAsufBCDSE, AmpR This study Red helper plasmid, pINT-ts derivative pKD46 containing araC-ParaB and γβexo, (Datsenko and Wanner, 2000) AmpR pET22(b)+ pET::nsrR pET::iscR Cloning and expression vector, AmpR Invitrogen pET22 derivative encoding NsrR-His, AmpR This study pET22 derivative encoding IscR-His, AmpR This study 3 Table S2. Sequence (5’ to 3’) of the oligonucleotides used in this work. Primers 5SufB 3SufB EcoRI-sufA XhoI-sufA NdeI-iscR XhoI-iscR NdeI-nsrR XhoI-nsrR 5TFhmp 3TFhmp Sequence Cloning of sufB and sufA GCATGAATTCATGTCTCGTAATACTGAAGCAAC CCTCTCGAGTTATCCGACGCTGTGTTCAAGACTGATGGC CTTCGAATTCATGGACATGCATTCAGGAACCTTTAAC GTTCTCGAGCTATACCCCAAAGCTTTCGCCACAGC Cloning of iscR and nsrR(in pET22) CGCCATATGAGACTGACATCTAAAGGG GTTCTCGAGAGCGCGTAACTTAACGTCGATCGC TATACATATGCAGTTAACGAGTTTCAC CCGCTCGAGCTCCACCAGCAATAATTTATAAAGCGG Construction of the PhmpA::lacZ gene fusion GCGGAATTCGTTGGACAACGGCGAACAG Construction of the Phmp::lacZ gene fusion GACGGGATCCCCGGTTTGAGCGTCAAGCATATGGTC boiteNsr/hmpA 4 5