The Anastasia of the Titanic
Bender 2014
On April 10, 1912, the Titanic, largest ship afloat, left Southampton, England on her maiden
voyage to New York City. The White Star Line had spared no expense in assuring her luxury. A
legend even before she sailed, her passengers were a mixture of the world’s wealthiest basking
in the elegance of first class accommodations and immigrants packed into steerage.
Four days into her journey, at approximately 11:40 p.m. on April 14, 1912, lookouts spotted
an iceberg directly in the path of the ship. Evasive action was taken in an attempt to avoid the
collision. A sharp turn to the port side was ordered, and the iceberg struck the ship on the right
side damaging the hull. Captain Smith ordered a full stop to assess the damage. Initially, only
five compartments were flooded, and the watertight doors had been closed to prevent
additional flooding. However, water was able to flow over the top of bulkheads and in through
normal openings causing two more compartments to flood. It quickly became obvious the
Titanic would sink. There were only enough lifeboats to service about half of the passengers on
board and less than 750 people were able to be evacuated.
Radio operators broadcasted distress signals, but the RMS Carpathia, the closest ship, was
four hours away. All but two lifeboats were successfully launched. Eventually, the Titanic split
and was completely sunk by 2:20 a.m. roughly four hours after receiving the distress call, the
Carpathia arrived and began rescue efforts. More than 1,500 people died.
Among the passengers on board was a toddler, Lorraine Allison, traveling with
her parents Hudson and Bess Allison and her seven-month-old brother Trevor.
Hudson Allison was a Canadian entrepreneur and the family traveled with an
extensive entourage of servants. When the ship struck the iceberg, Trevor their
young son, was not with his family at the time, and it was later discovered that he
had been taken onto a lifeboat by a maid, Alice Cleaver, with both the maid and
Trevor going on to survive. Both the mother and father and Loraine were believed
to have died looking for Trevor and skipping their opportunities at being rescued.
But here the plot thickens see the following excerpt:
CHILD FEARED LOST ON TITANIC REPORTED LIVING IN MICHIGAN
Chicago Tribune
Thursday 5 September 1940 Montreal, Que., Sept. 4 (AP)
A Montreal family was stirred today by the prospect that Lorraine Allison, long believed to have
been drowned in the Titanic disaster of 1912, still is alive and residing in Berkley, Mich., as Mrs.
Laurence Kramer. The family is that of Mrs. G. B. Allison, sister in law of Hudson J. C.
Allison, Montreal financier, who was drowned with his wife when the Titanic went down 28
years ago. Also presumed to have been lost was Lorraine, the Allison’s 3 year old daughter.
After the sinking, Allison's body was recovered, but those of his wife and child never were
found. Today it was learned Mrs. Kramer had written to the United States department of justice
claiming to be Lorraine.
1
The Anastasia of the Titanic
Bender 2014
The whole identification fiasco stems from the fact that little Loraine’s body was never
recovered, despite early news reports saying that she perished.
In 1940, when Kramer went public with the claim that she was saved from the Titanic at the
last moment when Hudson Allison, Loraine’s father, placed her in a lifeboat with a man she
grew up believing was her biological father. Kramer said she was rescued and taken to England
by a man who called himself “Mr. Hyde.” Kramer said she later discovered Mr. Hyde was
actually Thomas Andrews, who designed and helped build the ship. Andrews was also
presumed dead after the ship sank. These claims could not be verified because the man died
shortly after telling her his identity. One hundred years later no one can actually prove exactly
what happened. All we have to go by are the statements made by survivors, any surviving
documentary evidence, and the testimony from the U.S. and British inquiries. Hudson’s body
was the only one recovered. Mrs. Kramer, if she is able to prove that she is the missing
Lorraine, may be an heiress to the considerable Allison fortune in Montreal.
Loraine was the only child from first or second class that went down with the ship. Or did she?
Further news reports from 1912 possibly supported Kramer’s claim
LITTLE GIRL SAVED MAY BE LORRAINE ALLISON
MANITOBA MORNING FREE PRESS APRIL 20 1912
There is a faint hope that a little unknown girl picked up in a lifeboat by an immigrant woman,
may be Lorraine Allison, the Montreal child who is said to have perished with her father and
mother. In a brief interview granted to the Free Press tonight by J. Wesley Allison of
Morrisburg, the latter gave some details of the manner in which H.J Allison, Mrs. Allison and
their little daughter Lorraine, were lost on the Titanic, while the three maids and the baby were
brought home alive. H.J Allison was a partner in the firm of Johnson and Allison of Montreal,
and was for a time in business in Winnipeg, leaving that city about 3 years ago. On the night of
the disaster the family had retired. When the vessel struck, one of the maids ran upstairs with
the baby in her arms. She was not seen again and it is supposed was bundled on board one of
the boats shortly after she reached the deck. Strangely enough, the other 2 maids were also
placed on one of the boats. Neither knew the other had been saved till they all met on the
Carpathia. The others were not heard of again, and Mr. Allison supposed they perished when
the vessel broke in two with the explosion of her boilers. The baby has been sent to a
grandmother in Montreal, where she will be cared for. Tonight Mr. Allison has been notified
that a woman survivor of the Titanic, who came ashore on the Carpathia, has in her possession
a baby girl which she alleges was thrown to her in one of the boats. Mr. Allison entertains the
hope that the baby may be the lost Lorraine, and that Mrs. Allison, realizing that she could not
be saved, gave her little girl in the care of those in a boat below. Mr. Allison will tomorrow go to
the house at which the woman resides in hope of identifying the unclaimed girl .
2
The Anastasia of the Titanic
Bender 2014
Fast-forward to 2012, the 100th anniversary of the sinking of the Titanic. A woman going by
the name of Debrina Woods starts posting on the various Titanic websites and forums that she
is Mrs. Kramer’s granddaughter. Mrs. Kramer died in 1992. Woods claims that she has
apparently found a suitcase belonging to her grandmother that is full of documents, mainly
letters between Mrs. Kramer and a lawyer from Morrisburg, Ontario, Canada, that she claims
proves that her grandmother really was Loraine Allison.
The Loraine Allison Identification Project has been formed in order to forensically investigate
this claim. The project has the support of the immediate Allison descendants, and more than a
dozen of them are prepared to provide DNA samples to the project for independent forensic
DNA testing, should they be deemed to be a potential match The project is also in contact with
other branches of the family to request DNA samples to make sure that every base is
covered. All Ms. Woods need do is also agree to provide her certified sample, and the testing
will begin.
THE LAB:
The following activity is designed to demonstrate the techniques used by molecular
geneticists and forensic pathologists. Today you will perform an activity known as DNA
fingerprinting or electrophoresis. You have been provided with samples of mitochondrial DNA
sequences. These samples are designed to represent one-half of a strand of replicated DNA.
The base sequences found within these strands are unique to you and your maternal relatives
and can be used as a means to identify a person from a sample of bodily fluid. With nuclear
DNA, a child receives half of its DNA from each parent. In any given strand, half of the
sequence will match the mother’s DNA and the other half will match the father’s DNA. In the
case of mitochondrial DNA, an exact copy is inherited from your mother as it has been passed
from all of the female relatives on your mother’s side of the family.
During the actual process of electrophoresis, DNA is removed from a tissue sample, (such
as blood or hair). This DNA contains hundreds of copies of each DNA strand. The DNA molecules,
hundreds of thousands of bases long, are cut into smaller pieces using several different restriction
enzymes. These enzymes only cut the DNA where specific sequences of bases occur. The result
of the enzyme activity is a pool of DNA fragments that are sorted by size. This is accomplished by
taking advantage of the electrical charge on each one of the fragments. As an electric current is
passed through a semi-permeable agarose gel the various fragments are pulled through the gel
at different rates. The rate and distance migrated depends on the charge and the length of each
of the pieces. The DNA is then treated so that the two strands come apart, exposing single strands
of DNA bases. The gel is then transferred to a thick, sturdy piece of paper. The paper is then
soaked in a solution containing tiny single stranded DNA fragments. These fragments are
radioactive markers, called probes, which will attach to complementary bases in the cut up DNA
3
The Anastasia of the Titanic
Bender 2014
strands. The treated paper will allow the probes to stick to the appropriate bases, and the
remainder of the probes is washed away. The piece of paper is then placed on X-ray film, and the
film is developed. A dark spot appears wherever a radioactive probe stuck to the DNA. The result
is a unique pattern of spots called the DNA fingerprint. This fingerprint is unique to the individual,
and can be repeated with tissue samples from any bodily fluid, with the exception of red blood
cells, and achieve the same result. Why not red blood cells? Mature red blood cells do not contain
a nucleus, and as a result do not contain enough reliable DNA to produce a true test. If red blood
cells are the only source of DNA, the DNA must be cloned using a process known as PCR
(polymerase chain reaction) so that enough DNA is present in order to get an accurate test. You
will now use the materials provided to simulate such a test.
Who are the players in this controversy?
David Allison
David is the grandson of Percy Allison, Hudson Allison’s younger brother. Dave has become the
spokes-person for the 15 direct descendants of Jesse and Phoebe Allison. . He has researched
the genealogies involved, and acquired numerous documents in the search for the correct
maternal descendants for the mtDNA testing.
Deanne Jennings
Deanne is a granddaughter of Mrs. Kramer. Her mother is Adele Ferguson, and her half-sister is
Debrina Woods. Deanne grew up hearing the same stories that the other Kramer children and
grandchildren were exposed to about Mrs. Kramer really being Loraine Allison, and a survivor of
the Titanic disaster. Deanne always had her doubts, and was willing to assist , with her DNA.
Sally Kirkelie
Sally is the granddaughter of Maybelle Nieman (née Daniels), Bess Allison’s sister. Maybelle and
Bess shared the same mtDNA, and Sally inherited it through Maybelle’s daughter. Loraine
Allison also inherited the same mtDNA from her mother, Bess Allison. Sally and Loraine Allison,
had the same mtDNA.
If Loraine Allison survived the Titanic, and had children, any descendants following a maternal
line would also have the same mtDNA. If Mrs. Kramer’s assertions that she was really Loraine
Allison were true, this would result in Sally and Deanne Jennings both having the same mtDNA.
Jeff Pohl
Jeff is the great grandson of Mrs. Kramer and Lester J. Walsh. Mrs. Kramer went by the name
of Evangeline at that time, and she and Lester had a son, Lester John Walsh, who had a
daughter, Kathleen Lynn Walsh. Kathleen is Jeff’s mother. Unfortunately, Jeff is not a
descendant from Mrs. Kramer through a direct female lineage, therefore, despite his
willingness, he was not an appropriate candidate in the first phase of mtDNA testing.
4
The Anastasia of the Titanic
Bender 2014
You will now use the materials provided to simulate such a test .
For these tests scientists were able to obtain mitochondrial DNA samples from the following
people Deanne Jennings granddaughter of Mrs. Loraine Kramer (the woman attempting to
claim the fortune), Sally Kirkelie a maternal relative of the real Loraine Allison. David Allison a
paternal relative of Loraine Allison, and a sample from the male grandson, Jeff Pohl, of Loraine.
Remember the concept of heteroplasmy, where a very small portion of the mitochondrial DNA
might be a contribution from the male parent. This occurs only if the tail of the sperm enters
the egg during the process of fertilization. The head of the sperm is an empty vessel that
contains the DNA of the male parent, while the tail of the sperm must contain mitochondria to
supply energy for the process of locomotion.
In order to establish her claim to the fortune Loraine Kramer’s Mitochondrial
DNA must match Sally Kirkelie because he is a maternal relative to the Allison
Family
MATERIALS
1.
2.
3.
4.
5.
DNA sequence from Deanne Jennings
DNA sequence from Jeff Pohl
DNA sequence from Sally Kirkelie
DNA sequence from David Allison
DNA sequence standard to ensure the tests accuracy
PROCEDURE:
1. Review your data table and you will see the labels that should be attached to create 5
separate columns, as seen in the example below.
Deanne Jennings
Jeff Pohl
Sally Kirkelie
David Allison
Standard
MAKE SURE THAT YOU KEEP EACH PERSON’S DNA SEPARATE THROUGHOUT THIS ACTIVITY.
2. To simulate the action of radioactive probes use a highlighter and cover the letters CAT
in each of your segments.
3. With your PENCIL you are going to simulate the action of a restriction enzyme. Scan your
DNA strips until you find the letters “GG CC”. MARK across the strip between the letter
5
The Anastasia of the Titanic
Bender 2014
G and C, you will be forming a fragment that ends with a GG and another that begins with
a CC.
(Each sample has 5 of these sites so after cutting you will have 6 pieces. The standard contains 7 of these
sites so you will have 8 fragments)
4. Count the number of bases in each fragment, (the number of
letters). Match this number the chart provided. Then draw a line
in the box that corresponds to the number of letters in that
piece. See example on the right. Use your highlighter to mark the
position of each of the CAT sequences in each piece on the line
that you have drawn.
Skull fragment
20
18
16
5. You will compare the mtDNA sequences from the individuals involved. You are
attempting to determine if the mtDNA fragments are from an individual with the same
maternal lineage as Loraine Allison.
6. Place a star at the top of the DNA electrophoresis chart to indicate which samples, if any,
should be an exact match to each other
How will you know if the DNA samples are a match? How can you be sure that the samples
are from the same individual? What further tests might you be able to conduct?
6
The Anastasia of the Titanic
Bender 2014
Deanne Jennings
CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAG
GCCAAAGACGGCCATATAGGGGG
Jeff Pohl
CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAG
GCCGAATCAGGCCTTATTGCAGG
Sally Kirkelie
CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATAGGCCGAT
ACAGCCGATGGCCATATAGGGGG
David Allison
CCGAGGCCAGGGTATACCGGTATAGGCCAAATTTGGCCGGCATAGGCCGG
AATACAGCCGATGGCCATATATAGGGGG
Standard
CCAAGACATTATGCAGATGGCCAATAGACATTACGGCCATACCAGAGGCC
AACATGGCCAAACACACCCATCAGGCCATGGCAGACAGGCCATACGG
7
The Anastasia of the Titanic
Bender 2014
Use this space to answer the question as to whether the skull and the hair come from the same
donor.
8
The Anastasia of the Titanic
Bender 2014
Skull Fragment
Beethoven’s
Mother
Hair Sample
Beethoven’s Father
Standard
Number of Bases
From Longest to
Shortest
Number of Bases
From Longest to
Shortest
Number of Bases
From Longest to
Shortest
Number of Bases
From Longest to
Shortest
Number of Bases
From Longest to
Shortest
20
18
16
14
12
20
18
16
14
12
20
18
16
14
12
20
18
16
14
12
20
18
16
14
12
Overlap Chart Here
These numbers indicate the possible number of Base Pairs in each of the pieces of DNA that can occur after the action of restriction enzymes
Skull Fragment
Beethoven’s
Hair Sample
Beethoven’s
Standard
Mother
Father
9|Page
The Anastasia of the Titanic
10
9
8
6
10 | P a g e
10
9
8
6
10
9
8
6
Bender 2014
10
9
8
6
10
9
8
6