LEGENDS TO SUPPLEMENTARY DATA Supplementary Data S1: Effects of anti-p53 siRNAs or homozygote gene knock-out of p53 on ESC cardiomyogenesis and endothelial differentiation Undifferentiated CGR8 ESCs were transfected overnight with control siRNAs (si Ct) or anti-p53 siRNAs (si p53). The day after, day0, these cells and p53-/- ESCs (p53-/-) and their wild-type counterparts (p53+/+) were induced to differentiate, cultivated until day7 and replated on Petri dishes until day12 for analysis of cardiomyogenesis (A) or endothelial differentiation (B, C). mRNAs were extracted and analyzed by real time RT-PCR for Nkx2.5 (A), Tie2 (B) and VEGF Receptor 1 (Flk1) (C) gene expression. Results are expressed in arbitrary units, with the values of untransfected CGR8 control cells or wild type control ESCs taken as 1, and are the means ± S.E.M. of at least 3 independent experiments. Significance to Ct values is given as: *p < 0.05, **p < 0.01, ***p < 0.001. Supplementary Data S2: Oct4 and TBX1 gene regulation in p53-/- ESCs p53-/- ESCs (p53-/-) and their wild-type counterparts (p53+/+) were induced to differentiate and mRNAs were extracted at various time from day0 to day12, as indicated, and analyzed by real time RT-PCR for the expression of TBX1 (A) or Oct4 (B) gene expression. Results are expressed in arbitrary units, with the values of wild type control ESCs at day0 taken as 1, and are the means ± S.E.M. of at least 3 independent experiments. Significance to wild type control ESC values is given. Supplementary Data S3: Effects of anti-Nanog transfections in p53-/- ESCs Undifferentiated p53-/- ESCs were transfected overnight with control siRNAs (si Ct) or anti-Nanog siRNAs (si Nanog) and induced to differentiate until either day7 (A and B) or day12 (C). mRNAs were extracted at various time, as indicated and analyzed by real time RTPCR for Pax6 (A), Bcl2 (B), and Nkx2.5 (C). Results are expressed in arbitrary units, with 1 the values of control cells taken as 1, and are the means ± S.E.M. of at least 3 independent experiments. 2 Gene Supplementary data Table 1: sequences of the primers used in RT-qPCR Forward Reverse Housekeeping gene 36B4 TCCAGGCTTTGGGCATCA CTTTATCAGCTGCACATCACTCAGA Endothelial markers FLK-1 TCTGTGGTTCTGCGTGGAGA GTATCATTTCCAACCACCCT Tie2 ATGTGGAAGTCGAGAGGCGAT CGAATAGCCATCCACTATTGTCC Smooth muscle markers α-SMA GAGAAGCCCAGCCAGTCG CTCTTGCTCTGGGCTTCA Cardiomyocytes markers NKX2.5 ACCTTTCTCCGATCCATCCCACTT GCGTTAGCGCACTCACTTTAATGG Troponin T2 GCGGAAGAGTGGGAAGAGACAGAC GCACGGGGCAAGGACACAAG GCATCAACCTGCTGCAATCC GAGAAGTATTCACAAGCCCTGCTT Neural markers MAP2 Myogenesis markers Myh1 GGTCGAAGTTGCATCCCTAA CACAAACACCGATGACTTGG Adipogenic markers aP2 TTCGATGAAATCACCGCAGA GGTCGACTTTCCATCCCACT PPARγ CTGTTTTATGCTGTTATGGGTGAAA GCACCATGCTCTGGGTCAA Nanog AACGATATGGTGGCTACTCTC TCGGTTCATCATGGTACAGTC Oct-4 TGTGGACCTCAGGTTGGACT CTTCTGCAGGGCTTTCATGT ESCs and iPSCs Mesoderm comittment Brachyury GTGACTGCCTACCAGAATGA ATTGTCCGCATAGGTTGGAG Tbox-1 CTGTGGGACGAGTTCAATCAG TTGTCATCTACGGGCACAAAG Mesp-1 TGTACGCAGAAACAGCATCC TTGTCCCCTCCACTCTTCAG Ectoderm comittment Pax-6 TGCCCTTCCATCTTTGCTTG TCTGCCCGTTCAACATCCTTAG Mouse p53 and p53 targets 3 p53 AGAGACCGCCGTACAGAAGA GCATGGGCATCCTTTAACTC P21 CCTGGTGATGTCCGACCTG CCATGAGCGCATCGCAATC BCL2 ACAGTGGCAAGTGTCTTAGAAAG CTCCTCACCGGGTTTGGAAC 4