Madan et al
TIGAR Induces p53-Mediated Cell-Cycle Arrest by Regulation of RB-E2F1 Complex
Esha Madan
1, 2
2
3
4
, Rajan Gogna , Periannan Kuppusamy , Madan Bhatt , Uttam Pati
2, $
, Abbas Ali Mahdi
1
Department of Biochemistry, Chhatrapati Shahuji Maharaj Medical University, Lucknow-226003, India;
Transcription and Human Biology Laboratory, School of Biotechnology, Jawaharlal Nehru University,
2
3
New Delhi-110067, India; Department of Internal Medicine, Ohio State University Medical Centre,
4
Columbus 43210, Ohio; Department of Radiotherapy and chemotherapy, Chhatrapati Shahuji Maharaj
$
Medical University, Lucknow-226003, India; Senior corresponding authors.
Running Head: TIGAR induces G1-arrest by stabilization of RB-E2F1 complex
Key words: p53, TIGAR, RB, CDK, Cyclins, Cell-cycle arrest, Hypoxia, Tumor regression
Financial Support: UGC “capacity build up fund” & NIH RO1 grant- NIH EB004031.
Conflict of Interest: All the authors declare no conflict of interest.
Number of Figures: 5
Address for correspondence
Prof. Abbas Ali Mahdi PhD, Department of Biochemistry, Chhatrapati Shahuji Maharaj Medical
University, Lucknow-226003, India, Email: mahdiaa@rediffmail.com, phone: +91-9415007706.
Prof. Uttam Pati PhD, School of Biotechnology, Jawaharlal Nehru University, New Delhi-110067, India,
Email: uttam@mail.jnu.ac.in, phone: +91-9312401811.
1
1, $
Madan et al
Supplementary Figure Legends
Figure S1. Luciferase assay was conducted to analyze the transcriptional activity of p53 on TIGAR
promoter in UV-treated KB cells. The p53 response element on TIGAR promoter was cloned
in pGL3 vector and was used to study p53-mediated trans-activation. KB cells were treated
with increasing dose of UV ranging from UV-5 to UV-50 for 24 h and the luciferase activity
was recorded. The results show that p53 induces maximum trans-activation on TIGAR
promoter at low doses of UV (mainly UV-20- UV-35). On increasing the UV dose there is a
considerable drop in the luciferase activity. Internal control, empty vector, p53 siRNA and
p53-scrambled siRNA serves as controls for the experiment; (n=8, S.D, ANOVA).
Figure S2. (A) The effect of varying doses of UV stress (from UV-0 to UV-50) is observed in the
expression of TIGAR protein using in-vivo ELISA. Results show that TIGAR protein is
synthesized in KB cells exposed to low doses of UV-stress (UV-15 to UV-35). High doses of
UV stress abolish TIGAR protein expression (n=7, error bars represent S.D and significance
is measured using ANOVA) (the box marks the zone of UV stress where TIGAR protein
expression is observed). (B) The effect of TIGAR protein and varying doses of UV stress is
observed on the cellular glycolytic rate. KB cells were exposed to varying doses of UV stress
(UV-0 to UV-50) and its effect on the glycolysis is measured. Results show that the
glycolysis rates are low in KB cells exposed to low doses of UV (UV-15 to UV-35). The
decrease in glycolysis was coinciding with the increase in the expression of TIGAR protein
level in KB cells exposed to low doses of UV stress. With increasing doses of UV (UV-40 to
UV-50) the glycolytic rates were high and again the TIGAR protein expression is low. In
order to establish if UV-mediated variation in TIGAR expression levels were responsible for
variation in the cellular glycolysis rates the TIGAR gene was silenced using TIGAR siRNA.
Results show that TIGAR gene-silencing abolished the UV-induced alterations in the cellular
glycolytic rates suggesting that variation in the TIGAR protein level were responsible for the
changes in the glycolytic rates (the boxes indicate the doses of UV where changes in the
2
Madan et al
cellular glycolytic rates are observed) (n=5, error bars represent S.D and significance is
measured using ANOVA).
Figure S3. (A) TIGAR protein determines the cellular ATP levels. The cellular ATP content was
determined in KB cells where TIGAR cDNA was exogenously added and also TIGAR gene
was silenced using si-RNA. Results showed that TIGAR protein significantly reduced cellular
ATP content (lane 9) (n=10, error bars represent S.D and significance is measured using
ANOVA); internal control of the experiment and the TIGAR scrambled siRNA serves as
controls. (B) The effect of varying doses of UV (UV-0 to UV-50) on cellular ATP level was
observed in KB cells (black dots). The role of TIGAR in regulation of ATP levels was
observed by silencing TIGAR gene in UV-treated KB cells (red dots) (n-7, error bars
represent S.D and significance is measured using ANOVA).
Figure S4. (A) The role of p53 in TIGAR upregulation in tamoxifen-treated KB cells was observed using
in-vivo ELISA. Results show that tamoxifen-induced TIGAR protein expression is abolished
upon p53 gene silencing (lane 2 and 3) (n=5, error bars represent S.D and significance is
measured using ANOVA, * represents significance, p value less than 0.034). (B) The effect
of p53 and TIGAR was observed upon tamoxifen-induced cell-cycle arrest. Tamoxifen
induces G1-phase arrest with 85% cell present in the G1-phase. Upon p53 gene silencing
the tamoxifen-induced G-phase arrest was abolished and only 50% cells were present in the
G1-phase. Interestingly upon ectopic expression of TIGAR protein in tamoxifen-treated and
p53 (-/-) cells (via p53 gene silencing) the G1-phase arrest was again observed with 84%
cells present in the G1-phase. This data suggests that p53-induces TIGAR and TIGAR
induces cell-cycle arrest as down-stream effector of p53 (n=7, error bars represent S.D and
significance is measured using ANOVA, * represents significance, p value less than 0.042
and 0.024).
3
Madan et al
MATERIAL AND METHODS
Chemicals and antibodies
Dulbecco's modified Eagle's medium (DMEM), penicillin, streptomycin, fetal bovine serum (FBS), and
trypsin/EDTA and other chemicals of culture grade were purchased from Gibco Life Sciences (India).
Tamoxifen, PI, DAPI and phalloidin (fluorescein isothiocyanate-labeled) were purchased from Sigma (Saint
Louis, MO, USA). Adenosine 5’-triphosphate (ATP) bioluminescent somatic cell assay kits was purchased
from Sigma (Saint Louis, MO, USA). Antibodies for TIGAR (anti-goat IgG) and α-tubulin (anti-mouse IgG)
were procured from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-rabbit primary antibodies for
p21, p27, p57, p16, ATM, ATR, BRCA1, CHK1, CDKNK1A, Cyclin D1, E2F1, RB and phospho-RB; antimouse primary antibodies for CDK4 and CDK6 were procured Cell Signaling Technology (Beverley, MA,
USA).
Cell lines and culture conditions
KB cells were obtained from the National Center for Cell Sciences (Pune, India). The cells were cultured as
monolayers in DMEM medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum and
antibiotics, and incubated at 37°C in a humidified atmosphere of 95% air and 5% CO 2.
Transfections
p53 siRNA and TIGAR siRNA were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Cells
were split 2 days before transfection at the density of 5 x105 cells per plate. siRNA were transfected in cells
using ESCORT IV kit (Sigma). In-vivo cDNA transfections were made using in-vivo transfection kit from
Altogen Biosciences.
Animal and Diet
Swiss albino mice (male, 6-8 weeks old, 10–12 g body weight) were obtained from C.S.M.M.U. UP
(Lucknow, India) animal breeding colony. Animals were quarantined for 1 week on a 12/12 hour light/dark
4
Madan et al
cycle and were fed solid pellet diet (Ashirwad, Chandigarh, India) and water ad libitum. Animals were divided
in two groups as control and experimental with 10 mice in each group (n = 10).
Separate batches (for eight separate experiments) of BALB/c nu/nu, athymic mice (n = 10)/experiment,
aged 5 to 6 weeks old, were maintained in micro-isolator cages (2/cage) within a pathogen-free isolation
facility with 12 light/dark cycle at 22 to 24°C and 50% humidity. The basal diet (BD) was based on the AIN93G formulation, modified to have a high fat content (20% corn oil) at the expense of corn starch. The FS
diet was BD supplemented with 10% freshly ground FS corrected for the contribution of FS to fat, fiber, and
protein components so that the energy values of the diets were maintained.
UV exposure and drug treatment
Experimental mice and exponentially growing cells were exposed to UV at a dose of 25 (low) or 50 (high)
J/cm2 with a Stratalinker 2400 UV crosslinker (Stratagene, La Jolla, CA). To equalize the irradiation
conditions, medium was removed from the culture dishes during UV irradiation. Immediately after irradiation,
the cells were incubated under standard culture conditions for 24 hr.
The optimal concentration of tamoxifen was established by standard curve (5–100nM) and set as the
maximal non-toxic effect at 10 and 100nM. Indicated doses were applied topically on shaved dorsal skin of
mice in the inter-scapular region of 2 cm 2. Tissue from the exposed area of mice was extracted;
homogenates prepared and assayed for protein expression. The cells were treated for 24 h with selected
doses of tamoxifen. Cells were harvested, centrifuged and assayed for mRNA and protein expression. In
each protocol, experiments were repeated at least three times and the representative data were displayed in
the results.
Reverse-transcriptase PCR
Cells were lysed in appropriate amount of trizol (1 ml trizol per well of a 6 well plate for cultured cells). Cells
were repeatedly and vigorously pipetted. Cells were then kept at room temperature for 5-10 minutes, and
then 200 ul of chloroform per 1 ml of trizol was added and mixed thoroughly. The cells were again left at
room temperature for 10 minutes. Cells were then centrifuged at 12,000 rpm at 4°C for 15 minutes and the
5
Madan et al
upper aqueous colorless layer was transferred to a fresh eppendorf tube. To this eppendorf tube 75 l LiCl
(lithium chloride) followed by 1 ml chilled EtOH (ethanol) were added and kept at -20°C for 2-3 hours. The
eppendorf tube was centrifuge at maximum speed (>=12000 rpm) for 15 minutes at 4°C. The supernatant
was discarded and 250 µl of 70% ethanol was added and the tube was kept at room temperature for 2
minutes. The tube was again centrifuged at 7500 rpm for 5 minutes at 4°C, finally the supernatant was
discarded and the pellet was re-suspended in RNA grade water till it was completely dissolved. Single strand
c-DNA was synthesized for incubation with sense and anti-sense primers using revert aid TM h minus first
strand cDNA synthesis kit from fermentas. The resulting cDNA was diluted 1:10 before proceeding with the
PCR reaction. PCR was conducted in master-cycler gradient (Brinkmann Instruments). Each PCR reaction
used 50 µl cDNA, 2.5 U Taq polymerase (Eppendorf Scientific), 0.2 mM dNTPs and 0.5 µM primer. PCR
products were resolved on 2% agarose gel containing 0.01% (v/v) ethidium bromide and visualized by UV
illuminator. The size of the PCR amplicon was determined by comparison with 100-bp DNA ladder
(Promega).
RT-PCR primers:
Name
Sequence
β-actin forward
ATGAAGTGTGACGTTGACATCCG
β-ctin reverse
GCTTGCTGATCCACATCTGCTG
TIGAR forward
CGGAATTCAGAACAGTTTTCCCAAGGATCTCC
TIGAR reverse
CGGAATTCAACCTTAGCGAGTTTCAGTCAGTCC
Real-time PCR
Real-time PCR was performed using the 7500 fast real-time system (Applied Biosystems) using TaqMan
probe (Applied Biosystems) (98). GAPDH served as an endogenous control to normalize expression. Each
sample was analyzed in quadruplicate. Relative expression and standard error were calculated by the
supplied fast 7500 real-time system software.
6
Madan et al
Western blotting
Whole-cell lysates were prepared using RIPA buffer (10 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1% NP-40, 1
mM EDTA, 0.1% SDS, and 1 mM DTT). Cytoplasmic and nuclear protein fractions were prepared using
digitonin. Proteins were resolved by 10% or 12% SDS-PAGE and transferred onto PVDF membranes
(Invitrogen). Incubations with primary antibodies were followed by incubations with the appropriate
secondary antibodies (Amersham) and detection by ECL (Amersham). To quantify western-blot signals,
densitometry was performed using the software ImageJ.
Protein ELISA
The wells of a PVC microtiter plate were coated with polyclonal antibodies at a concentration of 1-10 μg/ml in
carbonate/bicarbonate buffer (pH 7.4). The plate was covered with an adhesive plastic and incubated
overnight at 4°C. Next the coating solution was removed and the plate was washed twice by filling the wells
with 200 μl PBS. The solutions or washes were removed by flicking the plate over a sink. The remaining
drops were removed by patting the plate on a paper towel. The remaining protein-binding sites in the coated
wells were blocked by adding 200 μl blocking buffer, 5% non-fat dry milk/PBS, per well. Again the plate was
covered with an adhesive plastic and incubated overnight at 4°C. 100 μl of appropriately diluted cell
suspension was added to each well and incubated for 90 min at 37°C. 100 μl (0.5 μg/ 100 μl) of diluted
detection antibody (monoclonal) was added to each well. The plate was covered with an adhesive plastic
and incubated for 2 h at room temperature. The plates were washed four times with PBS. 100 μl of
secondary antibody conjugated with horse raddish peroxidase was added to the plate. The plate was
covered with an adhesive plastic and incubated for 1-2 h at room temperature. The plate was washed four
times with PBS.
Cell-cycle analysis
Cells were collected by centrifuging then at 1,000 rpm at 4°C for 5 minutes. Cell pellet was resuspended in 1
ml of cold PBS. Cells were then fixed by adding 4 ml of cold absolute ethanol and stored at -20°C in this
fixation buffer until ready for analysis. Fixed cells were then centrifuged and the pellet was resuspended in 1
7
Madan et al
ml of PBS. 100 μl of 200 μg/ml DNase-free, RNaseA was added to cells and left for incubation at 37°C for 30
minutes. Then 100 μl of 1 mg/ml propidium iodide was incubated at room temperature for 5-10 minutes.
Finally the samples were transferred to 12x75 falcon tubes and read on Becton Dickinson (LSR) flow
cytometer.
ATP measurement
Adenosine triphosphate (ATP) bioluminescent assay kit was purchased from Sigma. Protocol was followed
as per the vendor’s instructions.
Immunoprecipitation
Cells were washed with PBS, harvested, lysed in radio-immune precipitation buffer (50 mm Tris-HCl, pH 7.4,
150 mm NaCl, 1.0% Triton X-100, 0.1% SDS, and 1.0% sodium de-oxycholate). The whole cell lysate was
pre-cleared, and 1.0 μg of polyclonal antibodies was used for immunoprecipitation. After 2-h incubation with
antibodies, 10 μl of protein A-agarose was added to the lysate and further incubated at 4 °C for 4 h. Washing
was done twice with Nonidet P-40 buffer (20 mm Tris-HCl, pH 7.4, 100 mm NaCl, 10% glycerol, 1.0%
Nonidet P-40, and 1 mm EDTA) and once with radio-immune precipitation buffer. Immuno-complexes were
released by the addition of SDS loading dye, boiled for 5 min, centrifuged, and loaded to 10% SDS-PAGE.
Transfer of proteins to nitrocellulose membrane was done and immunoblotted with target antibodies.
Measurement of glycolysis
For measurement of glycolysis, 106 cells were washed once in phosphate-buffered saline (PBS) prior to resuspension in 1 ml of Krebs buffer and incubation for 30 min at 37°C. Cells were then pelleted, resuspended
in 0.5 ml of Krebs buffer containing 10 mM glucose, and spiked with 10 μCi of 5-3H-glucose. Following
incubation for 1 h at 37°C, triplicate 50-μl aliquots were transferred to uncapped PCR tubes containing 50 μl
of 0.2N HCl, and a tube was transferred to a scintillation vial containing 0.5 ml of H 2O such that the water in
the vial and the contents of the PCR tube were not allowed to mix. The vials were sealed, and diffusion was
allowed to occur for a minimum of 24 h. The amounts of diffused and undiffused 3H were determined by
scintillation counting. Appropriate 3H-glucose-only and 3H2O-only controls were included, enabling the
8
Madan et al
calculation of 3H2O in each sample and thus the rate of glycolysis, as described previously (Ashcroft et al.,
1972).
Luciferase Assay
Cells were plated in 35 mm petri dishes the day before transfection so that they reached 60–80% confluence
upon transfection. Reporter plasmids (1.0–1.5 mg/well) were transfected with effectene transfection reagent
(Qiagen) as per the manufacturer’s instructions. After desired incubation period the cells were washed in
cold PBS three times and lysed with 200ml of the lysis buffer by a freeze-thaw cycle, and lysates were
collected by centrifugation at 14,000 rpm for 2 minutes in a bench top centrifuge. Twenty micro liter of
supernatant was used for the assay of luciferase activity using a kit (Promega) as per the manufacturer’s
instruction.
Tumor Induction
A 80 µl cell suspension containing 1 x 107 cells was subcutaneously injected into the hind legs of each mice,
thus producing a site of MCF-7 tumor per mouse. Tumor volumes were monitored weekly by calliper
measurement of the length, width, and height and were calculated using the formula for a semi-ellipsoid
(4/3 r3/2). After 3 weeks, mice bearing tumors with volumes averaging approximately 200 mm 3 were
randomized for treatment. Because of the variations in tumor and initial tumor growth as well as the removal
of mice for analysis at various time points, the number of mice at each time point varied from experiment to
experiment. The number of mice analyzed is reported in the text.
9