Mastering Concepts
7.1
1. How did Griffith’s research, coupled with the work of Avery and his colleagues,
demonstrate that DNA, not protein, is the genetic material?
Griffith’s research established that a then-unknown molecule in a lethal strain of bacteria
could transform nonlethal bacteria, making them able to kill mice. Avery and his
colleagues added enzymes that destroyed either proteins or DNA to the mixtures that
Griffith used in his experiments. In Avery’s experiments, mice died only from bacterial
solutions mixed with enzymes that destroyed proteins. Mice did not die from bacterial
solutions mixed with enzymes that destroyed DNA. These experiments showed that
DNA, not protein, changed bacteria from nonlethal to lethal.
2. How did the Hershey–Chase “blender experiments” confirm Griffith’s results?
The Hershey-Chase “blender experiments” used radioactive sulfur to label the protein
coats of one batch of bacteriophages and used radioactive phosphorus to label the DNA
of another batch of bacteriophages. Both batches of viruses were allowed to infect
bacteria. Then the solutions were separately blended at high speeds to separate viral
protein coats from bacterial cells. Radioactively labeled bacteria were only found in the
batches that had been infected by phages with radioactively labeled DNA. The proteinlabeled phages did not transmit radioactivity to the bacteria they had infected. These
experiments confirmed that DNA, not protein, is the genetic material.
7.2
1. What are the components of DNA and its three-dimensional structure?
The components of a DNA molecule are nucleotides. These are composed of a
deoxyribose sugar bonded to a phosphate and a nucleotide base (adenine, thymine,
cytosine, or guanine). The three-dimensional structure of DNA is a double helix, which
resembles a twisted ladder.
2. What evidence enabled Watson and Crick to decipher the structure of DNA?
The evidence included Rosalind Franklin’s X-ray diffraction photo of a crystal of DNA,
plus Erwin Chargaff’s work that showed that DNA contains equal amounts of adenine
and thymine and equal amounts of cytosine and guanine.
3. Identify the 3′ and 5′ ends of a DNA strand.
The 5’ end has the 5th numbered carbon in deoxyribose facing out and leading with a
phosphate group attached, and the 3’ end has the 3rd numbered carbon leading with no
phosphate, just the OH attached to the carbon.
7.3
1. What is the relationship between a gene and a protein?
A gene is a strand of DNA that encodes a protein.
2. What are the two main stages in protein synthesis?
Transcription and translation are the two main stages in protein synthesis.
3. What are the three types of RNA, and how does each contribute to protein synthesis?
Messenger RNA (mRNA) carries the DNA instructions for building the protein, transfer
RNA (tRNA) carries the appropriate amino acid to the ribosome, and ribosomal RNA
(rRNA) is the major component of a ribosome, the structure that reads codons on the
mRNA and assembles amino acids into polypeptides.
7.4
1. What happens during each stage of transcription?
The steps of transcription are initiation, elongation of the RNA molecule, and
termination. During initiation, enzymes unzip the DNA and RNA polymerase binds.
During elongation, RNA polymerase “reads” the DNA strand and adds complementary
nucleotides to the growing RNA strand. During termination, synthesis of the RNA
molecule ends and the DNA molecule reforms.
2. Where in the cell does transcription occur?
Transcription occurs in the nucleus.
3. What is the role of RNA polymerase in transcription?
RNA polymerase uses the DNA template to bind additional RNA bases into the growing
chain of RNA being transcribed.
4. What are the roles of the promoter and terminator sequences in transcription?
The promoter signals the start of a gene, and the terminator signals the end of a gene.
RNA polymerase recognizes the promoter and terminator, so it starts and stops
transcription at the correct positions.
5. How is mRNA modified before it leaves the nucleus of a eukaryotic cell?
Before it leaves the nucleus of a eukaryotic cell, mRNA is altered in the following ways:
- a cap is added to the 5’ end of the mRNA molecule;
-
a poly A tail is added to the 3’ end;
introns are removed and exons are spliced together.
7.5
1. How did researchers determine that the genetic code is a triplet and learn which codons
specify which amino acids?
Researchers knew that life uses four nucleotides and 20 amino acids. They reasoned that
the genetic code could not reflect 1-base or 2-base “words,” because neither could encode
enough amino acids. A triplet code (3-base “words”) could potentially encode 64 amino
acids, which is more than enough for the 20 amino acids found in biological proteins.
They deciphered the genetic code by adding synthetic mRNA molecules to test tubes
containing all the ingredients needed for translation. They analyzed the sequences of the
resulting polypeptides to determine which codons correspond to which amino acids.
2. What happens in each stage of translation?
The steps of translation are initiation (ribosomal subunit binds to initiator codon),
elongation of the polypeptide, and termination (release of the last tRNA from the
ribosome, signified by a stop codon).
3. Where in the cell does translation occur?
Translation occurs at ribosomes, which are either free in the cytoplasm or attached to the
rough ER.
4. How are polypeptides modified after translation?
Polypeptides have to be folded into proteins; sometimes amino acids are cut out of the
chain, and sometimes multiple polypeptides join together.
7.6
1. What are some reasons that cells regulate gene expression?
Protein production costs a lot of energy; the regulation of gene expression avoids the
production of unnecessary proteins and therefore saves energy.
2. How do proteins determine whether a bacterial operon is expressed?
A repressor protein binds to an operator and prevents the genes in the operon from being
transcribed.
3. How do enhancers and transcription factors interact to regulate gene expression?
Transcription factors bind to certain DNA sequences to regulate transcription, for
example by preparing a promoter site to bind RNA polymerase. Transcription won’t
occur without these factors. Enhancers are sequences of DNA outside of the promoter.
Transcription factors can bind to the enhancers to help regulate gene expression.
4. What are some other ways that a cell controls which genes are expressed?
Cells can keep DNA coiled or attach methyl groups to inactivate genes. During
transcription different introns can be spliced out. mRNA can be contained in the nucleus
or rapidly degraded. Proteins can also be degraded or modified in processing.
7.7
1. What is a mutation?
A mutation is a change in the DNA sequence of a cell.
2. What are the types of mutations, and how does each alter the encoded protein?
A point mutation changes one or a few base pairs of genes. Point mutations include
substitution mutations (which replace one DNA base for another), insertions, and
deletions. Substitution mutations might change one amino acid to another in the encoded
protein (which is called a missense mutation), might change an amino acid to a stop
codon (which is called a nonsense mutation), or might not change an amino acid (which
is called a silent mutation). Insertions of deletions of more or fewer than three nucleotides
will shift the “reading frame” of the gene; these frameshift mutations might alter many
amino acids in the protein, drastically changing its shape and function. An insertion of
three nucleotides adds one amino acid to the encoded protein. A deletion of three
nucleotides removes one amino acid from the encoded protein. Expanding repeat
mutations increase the number of copies of three-or four-nucleotide sequences over
several generations. This causes extra amino acids to be inserted into a protein,
deforming it.
3. What causes mutations?
Mutations are caused by DNA replication errors, errors in crossing over during meiosis,
chromosome inversions and translocations, or exposure to chemicals or radiation.
4. What is the difference between a germline mutation and a somatic mutation?
A germline mutation is one that occurs in a cell that will give rise to a sperm or an egg
cell. A somatic mutation occurs within a non-germline body cell.
5. How are mutations important?
Mutations are used to learn how genes normally function and to develop new varieties of
crop plants. Mutations can also be used to trace the evolution of viruses and other
infectious agents.
7.8
1. How can the number of proteins encoded in DNA exceed the number of genes in the
genome?
The 25,000 or so genes can make 400,000 proteins in part by changing which introns are
removed prior to splicing together the mRNA.
2. List some functions of the 98.5% of the human genome that does not specify protein.
Some of the 98.5% of the human genome that does not code for protein encodes rRNA,
tRNA, and regulatory sequences that control gene expression. It also contains
pseudogenes that may be remnants of non-functional DNA that encoded proteins in our
ancestors; transposons (transposable elements) that jumped from bacteria and viruses to
humans; and tandem repeats of DNA sequences in telomeres, centromeres, and on the Y
chromosome.
7.9
1. What is recombinant DNA?
Recombinant DNA is the combined DNA from 2 or more organisms.
2. What are transgenic organisms, and how are they useful?
Transgenic organisms are organisms that contain recombinant DNA. They produce drugs
and other useful chemicals, degrade pollutants, incorporate pesticides in their tissues, are
models for medical research, and secrete human proteins.
3. What are the steps in creating a recombinant plasmid?
The steps in creating a recombinant plasmid include:
- using restriction enzymes to cut out the gene sequence from donor DNA;
- cutting the plasmid with the same restriction enzymes;
- allowing the donor sequence to combine with the plasmid DNA.
4. How do bacteria, plant, and animal cells take up recombinant DNA?
Bacteria, plant, and animal cells are sometimes induced to take up recombinant DNA by
exposure to electricity. Scientists also make cells take up new DNA by shooting it into
cells with gene guns, inserting it into liposomes, and inserting it as plasmids into bacteria
that enter plant cells and inject the plasmids.
7.10
1. What is gene therapy, and why is it difficult to accomplish?
Gene therapy replaces faulty genes in the genome with functioning copies. Some
challenges are in directly delivering the gene to the specific cell that needs to express it,
having that expression last long enough to affect a cure, and not have the viral delivery
method trigger illness itself.
2. How do antisense RNA and gene knockouts silence genes?
Antisense RNA silences genes by adding an artificial complementary strand of RNA to
mRNA, making it a double strand. Ribosomes cannot translate double-stranded mRNA.
Gene knockouts silence genes by replacing a normal copy of a gene with a disabled
version that will not be transcribed.
3. How are DNA microarrays useful?
DNA microarrays can be used to quickly determine whether a particular gene or protein
is present in a cell. In more practical terms, they can tell how a cancer patient will
respond to a cancer drug and whether the drug will be effective against the cancer. DNA
microarrays also can be used to predict how effective an antibiotic will be against a
particular strain of bacteria.
7.11
1. What question about the FOXP2 gene were the researchers trying to answer?
Researchers wanted to know what and when mutations arose in the FOXP2 gene. They
also wanted to know if these mutations could be linked to human acquisition of language.
2. What insights could scientists gain by intentionally mutating the FOXP2 gene in a
developing human? Would such an experiment be ethical?
One possible insight: Researchers could mutate the FOXP2 gene so that it is nonfunctional at different stages of development to learn whether it is actively important
through all of development or just in a critical window. Such an experiment would not
be ethical.
Write It Out
1. Describe the three-dimensional structure of DNA.
DNA is a double helix that resembles a twisted ladder. In this molecule, the “twin rails”
of the ladder are alternating units of deoxyribose and phosphate, and the ladder’s rungs
are A-T and G-C base pairs joined by hydrogen bonds.
2. How would the results of the Hershey–Chase experiment have differed if protein were
the genetic material?
If protein were the genetic material, the bacteria infected by the sulfur-labeled virus
would have become radioactive.
3. Write the complementary DNA sequence of each of the following base sequences:
a. T C G A G A A T C T C G A T T
b. C C G T A T A G C C G G T A C
c. A T C G G A T C G C T A C T G
The complementary sequences are:
a) AGCTCTTAGAGCTAA
b) GGCATATCGGCCATG
c) TAGCCTAGCGATGAC
4. Put the following in order from smallest to largest: nucleotide, genome, nitrogenous
base, gene, nucleus, cell, codon, chromosome.
From smallest to largest, the order is nitrogenous base, nucleotide, codon, gene,
chromosome, nucleus, and cell.
5. What is the function of DNA?
The function of much of the DNA in a cell is not known, but some of it encodes the cell’s
RNA and proteins.
6. List the differences between RNA and DNA.
RNA nucleotides contain a sugar called ribose; DNA nucleotides contain a similar sugar
called deoxyribose. RNA has the nitrogenous base uracil, which behaves similarly to the
thymine in DNA - that is, both uracil and thymine form complementary base pairs with
adenine. RNA can be single-stranded; DNA is double-stranded. RNA can catalyze
chemical reactions, a role not known for DNA.
7. Define and distinguish between transcription and translation. Where in a eukaryotic
cell does each process occur?
Transcription copies the information encoded in a DNA base sequence into the
complementary language of mRNA. Once transcription is complete and mRNA is
processed, the cell is ready to translate the mRNA message into a sequence of amino
acids that builds a protein. Transcription occurs in the nucleus, and translation occurs at
ribosomes in the cytoplasm.
8. This chapter compared a chromosome to a cookbook and a gene to a recipe. List the
ways that chromosomes and genes are UNLIKE cookbooks and recipes.
Some differences could include: Unlike a cookbook, most of DNA in a chromosome is
noncoding. Unlike a recipe there are introns in a gene. You can’t cut out parts of the
recipe and put together the rest in various ways to make multiple food products.
9. Some people compare DNA to a blueprint stored in the office of a construction
company. Explain how this analogy would extend to transcription and translation.
Transcription would be the process of scanning or copying the blueprints so that the
contractor would have a set at the construction site. Translation would be the process of
the contractor directing the assembly of all the raw materials at the site into the finished
building.
10. List the three major types of RNA and their functions.
Messenger RNA (mRNA) carries the information that specifies a protein. Ribosomal
RNA (rRNA) combines with proteins to form a ribosome, the physical location of protein
synthesis. Transfer RNA (tRNA): molecules are “connectors” that bind mRNA codons at
one end and specific amino acids at the other. Their role is to carry each amino acid to the
ribosome at the correct spot along the mRNA molecule.
11. List the sequences of the mRNA molecules transcribed from the following template
DNA sequences:
a. T T A C A C T T G C T T G A G A G T T
b. G G A A T A C G T C T A G C T A G C A
The complementary sequences are:
a) AAUGUGAACGAACUCUCAA;
b) CCUUAUGCAGAUCGAUCGU
12. Given the following partial mRNA sequences, reconstruct the corresponding DNA
template sequences:
a. G U G G C G U A U U C U U U U C C G G G U A G G
b. A G G A A A A C C C C U C U U A U U A U A G A U
The complementary sequences are:
a) CACCGCATAAGAAAAGGCCCATCC;
b) TCCTTTTGGGGAGAATAATATCTA
13. Refer to the figure to answer these questions:
a. Add labels for mRNA (including the 5’ and 3’ ends) and tRNA. In addition, draw the
RNA polymerase enzyme and the ribosomes, including arrows indicating the direction of
movement for each.
b. What are the next three amino acids to be added to peptide b?
c. Fill in the nucleotides in the mRNA complementary to the template DNA strand.
d. What is the sequence of the DNA complementary to the template strand (as much as
can be determined from the figure)?
e. Does this figure show the entire peptide that this gene encodes? How can you tell?
f. What might happen to peptide b after its release from the ribosome?
g. Does this figure depict a prokaryotic or a eukaryotic cell? How can you tell?
a. Refer to figures 7.11 (Transcription of RNA from DNA) and 7.16 (Translation
Creates the Protein).
b. Lys-Gly-Ser
c. The remaining mRNA nucleotides are (from left to right): CUUAGGACACC
d. The complementary DNA sequence is (from left to right): CTTAGGACACC
e. No, because the last codon would be a stop codon (UAA, UAG, or UGA)
f. The peptide would fold into its proper shape and then either begin performing its
function in the cell or be exported to the cell’s exterior.
g. The figure depicts a prokaryotic cell. In eukaryotes, the mRNA is fully synthesized
in the nucleus, undergoes processing, and then is transcribed in the cytoplasm.
The figure shows translation occurring simultaneously with transcription, which
only occurs in prokaryotes.
14. Consult the genetic code to write codon changes that could account for the following
changes in amino acid sequence.
a. tryptophan to arginine
b. glycine to valine
c. tyrosine to histidine
a) UGG to CGG; b) GGU to GUU; GGC to GUC; GGA to GUA; GGG to GUG; c) UAU
to CAU; UAC to CAC
15. Titin is a muscle protein whose gene has the largest known coding sequence—80,781
DNA bases. How many amino acids long is titin?
The titan protein is 26,927 amino acids (80,781 nucleotides divided by 3 nucleotides per
amino acid).
16. If a protein is 1259 amino acids long, what is the minimum size of the gene that
encodes the protein? Why might the gene be longer than the minimum?
1259 x 3 = 3,777 bases plus three bases for stop codon = 3,780 bases. The gene would
have bases for the leader sequence on the mRNA and might include any number of
introns.
17. On the television program The X Files, Agent Scully discovers an extraterrestrial life
form that has a triplet genetic code but with five different bases instead of the four of
earthly inhabitants. How many different amino acids can this code specify?
125 (5x5x5)
18. A mouse’s genome has 1500 olfactory genes encoding proteins that enable the animal
to detect odors. In each olfactory sensory neuron, only one of these genes is expressed;
the others remain “off.” List all of the ways that a mouse cell might silence the unneeded
genes.
The mouse cell can keep DNA coiled or attach methyl groups to inactivate genes. During
transcription different introns can be spliced out. Messenger RNA can be contained in
the nucleus or rapidly degraded. The proteins can also be degraded.
19. The genome of the human immunodeficiency virus (HIV) includes nine genes. Two
of the genes encode four different proteins each. How is this possible?
The genes each contain several introns. To make each protein, a different combination of
introns are cut out with the remaining mRNA spliced together.
20. The shape of a finch’s beak reflects the expression of a gene that encodes a protein
called calmodulin. A cactus finch has a long, pointy beak; its cells express the gene more
than a ground finch, which has a short, deep beak. When researchers boosted gene
expression in a ground finch embryo, the bird’s upper beak was longer than normal.
Develop a hypothesis that explains this finding.
In the cactus finch the enhancer for the calmodulin gene is modified so that the
transcription factors work longer, causing a prolonged expression of the gene.
21. If a gene is like a cake recipe, then a mutation is like a cake recipe containing an
error. List the major types of mutations, and describe an analogous error in a cake recipe.
a) missense: instead of baking soda the recipe lists baking powder b) nonsense: a recipe
that cuts off after a partial list of ingredients c) frameshift: flour, wate, regg, ssuga, rsal
etc. d) deletion of three bases: a recipe that leaves out one ingredient e) duplication: a
recipe that lists an ingredient twice f) insertion: a recipe that lists one extra ingredient g)
expanding repeat: a recipe that lists an ingredient repeatedly.
22. A protein-encoding region of a gene has the following DNA sequence:
GTAGCGTCACAAACAAATCAGCTC
Determine how each of the following mutations alters the amino acid sequence:
a. substitution of a T for the C in the 10th position
b. substitution of a G for the C in the 19th position
c. insertion of a T between the 4th and 5th DNA bases
d. insertion of a GTA between the 12th and 13th DNA bases
e. deletion of the first DNA nucleotide
a. Point mutation; instead of incorporating the amino acid valine, the protein would
incorporate isoleucine.
b. Point mutation; instead of incorporating the amino acid valine, the protein would
incorporate leucine.
c. Frame shift mutation; arginine is replaced by glutamine, and the remainder of the
protein is disrupted.
d. Insertion mutation; the amino acid histidine is added within the protein.
e. Frame shift mutation; the entire protein is disrupted.
23. Explain how a mutation in a protein-encoding gene, an enhancer, or a gene encoding
a transcription factor can all have the same effect on an organism.
A mutation in the gene can lead to a polypeptide that is too short or has the wrong amino
acids; in either case it will not fold properly, and therefore will not function properly.
This means that the organism will not express the effects of that protein. This same result
can be achieved by mutation to the transcription factor so that it does not bind to the
gene, or conversely by mutating the enhancer so that a normal transcription factor cannot
bind. Both mutations will block transcription.
24. How can a mutation alter the sequence of DNA bases in a gene but not produce a
noticeable change in the gene’s polypeptide product? How can a mutation alter the amino
acid sequence of a polypeptide yet not alter the organism?
A mutation may alter the sequence of a gene but not produce a noticeable change in the
gene’s polypeptide sequence because several different codons encode most amino acids.
A mutation may alter the amino acid sequence but not alter the phenotype because the
protein’s shape may not change, other proteins may take over the altered protein’s
function, or the protein may not be essential.
25. Parkinson disease causes rigidity, tremors, and other motor symptoms. Only 2% of
cases are inherited, and these tend to have an early onset of symptoms. Some inherited
cases result from mutations in a gene that encodes the protein parkin, which has 12
exons. Indicate whether each of the following mutations in the parkin gene would result
in a smaller protein, a larger protein, or no change in the size of the protein.
a. deletion of exon 3
b. deletion of six consecutive nucleotides in exon 1
c. duplication of exon 5
d. disruption of the splice site between exon 8 and intron 8
e. deletion of intron 2
a) smaller protein b) smaller protein c) larger protein d) no change e) no change
26. In a disorder called gyrate atrophy, cells in the retina begin to degenerate in late
adolescence, causing night blindness that progresses to blindness. The cause is a mutation
in the gene that encodes an enzyme, ornithine aminotransferase (OAT). Researchers
sequenced the OAT gene for five patients with the following results:
• Patient A: A change in codon 209 of UAU to UAA
• Patient B: A change in codon 299 of UAC to UAG
• Patient C: A change in codon 426 of CGA to UGA
• Patient D: A two-nucleotide deletion at codons 64 and 65 that results in a UGA
codon at position 79
• Patient E: Exon 6, including 1071 nucleotides, is entirely deleted.
a. Which patient(s) have a frameshift mutation?
b. How many amino acids is patient E missing?
c. Which patient(s) will produce a shortened protein?
a) patient D b) 357 c) all will produce a shortened protein
27. Researchers use computer algorithms that search DNA sequences for indications of
specialized functions. Explain the significance of detecting the following sequences:
a. a promoter
b. a sequence of 75 to 80 nucleotides that folds into a cloverleaf shape
c. a gene with a sequence very similar to that of a known protein coding gene but that is
not translated into protein
d. RNAs with poly A tails
a) a promoter will signal the start of a gene b) these nucleotides comprise a tRNA
molecule c) this could be a pseudogene d) the poly A tails signal an mRNA
28. How do researchers create recombinant DNA and transgenic organisms, and what are
some applications of this technology?
Restriction enzymes are proteins that cut double stranded DNA at a specific base
sequence. Biologists use these enzymes to cut segments of DNA from different sources.
When plasmid and donor DNA is cut with the same restriction enzyme and the fragments
are mixed, the single stranded sticky ends of the plasmids base pair up with those of the
donor DNA. DNA ligase then seals the segments together. Transgenic organisms contain
recombinant DNA and have a variety of practical uses, including agricultural and
pharmaceutical production.
29. Transgenic crops often require fewer herbicides and insecticides than conventional
crops. In that respect, they could be considered environmentally friendly. Use the Internet
to research the question of why some environmental groups oppose transgenic
technology.
One argument is that interfering with another species is unethical. A second argument is
that the repercussions on the natural environment are unknown. A third argument is that
transgenic organisms may escape into the natural ecosystem. There are other arguments
as well.
30. Define gene therapy, antisense RNA, gene knockout, and DNA microarray.
Gene therapy is the removal of a faulty gene and replacement with a functioning copy.
Antisense RNA is the complement to the sense strand. Gene knockout is a technique that
renders a gene nonfunctional in an organism so that the effects of the gene can be
learned. DNA microarray is a chip with many short DNA sequences imbedded. The
chip then binds complimentary pieces of an unknown DNA sequence so that it can be put
in order.
31. Which biotechnology might be able to accomplish the following goals? More than
one answer may be possible.
a. Shut off HIV genes integrated into the chromosomes of people with HIV infection
(which leads to AIDS).
b. Create bacteria that produce human growth hormone, used to treat extremely short
stature.
(a) Antisense RNA or gene knockout technology. (b) Recombinant DNA (transgenic)
technology.
32. Explain the ethical issues that gene therapy presents.
There are many issues, some of which could include: who decides which genes need to
be changed and are not normal, will the technology be misused to create custom children,
and will the technology be available to all.
33. Many patients waste precious time taking anticancer drugs that are ineffective or too
toxic. How might DNA microarray technology refine the treatment of cancer?
DNA microarray technology might better enable doctors to identify a particular cancer so
that the appropriate treatment can begin immediately.
34. A young zebra finch must learn to sing. Researchers used a modified virus to deliver
a “mirror image” of the FOXP2 gene to the brain of a young finch. With the FOXP2 gene
silenced, the bird’s song-learning ability was impaired. Why did the treatment silence the
gene? How does this experiment relate to the study of human language?
The treatment knocked out the normal FOXP2 gene. This relates to human language,
since like birds, humans cannot acquire proper language skills in the absence of a
functioning FOXP2 gene.
35. Choose an experiment mentioned in the chapter and analyze how it follows the
scientific method.
The Hershey-Chase experiment is one example that illustrates the scientific method.
Their question was which molecule in the cell (DNA or protein) contained the genetic
material. Their hypothesis was that DNA was the genetic material of a cell. They
designed an experiment using a virus that infects the bacterium Escherichia coli. They
labeled two batches of this virus, one with radioactive sulfur that marked protein, and the
other with radioactive phosphorus that marked DNA. They allowed the viruses to infect
two separate batches of bacteria. They then agitated each mixture in a blender, poured
these mixtures into test tubes, and then spun them at high speeds to separate the viral
protein coats from the infected bacteria in each tube. Hershey and Chase then collected
their data by examining the contents of the test tubes. In the test tube containing sulfurlabeled virus, the bacteria were not radioactive, but the fluid portion of the material in the
test tube was. In the tube where the virus contained radioactive phosphorus, the infected
bacteria were radioactive, but the fluid was not. Hershey and Chase therefore concluded
that the part of the virus that entered the bacteria was the part with the phosphorus label –
the DNA.
36. Give an example from the chapter of different types of experiments used to address
the same hypothesis. Why might this be necessary?
Both the experiment by Avery, Macleod, and McCarty and the experiment by Hershey
and Chase supported the conclusion that DNA is the biochemical of heredity. Using
multiple lines of evidence helps strengthen a conclusion.
Pull It Together
1. Why is protein production essential to cell function?
Cell structure and function depend on proteins. Enzymes are proteins and are required
for almost all chemical reactions to occur within a cell. Without enzymes, the cell could
not synthesize ATP, which the cell uses for energy. In addition, proteins embedded
within cell membranes have several important functions such as adhesion, cell
recognition, and transport of water-soluble molecules; without protein production new
cell membrane proteins could not be produced when the cell divides.
2. Where do promoters, terminators, stop codons, transcription factors, RNA
polymerase, and enhancers fit into this concept map?
Both “transcription factors” and “RNA polymerase” can connect to “promoters” with
“bind to”. Both “promoters” and “terminators” can lead to “DNA” with the connecting
phrase “are non-coding sequences of”. “Promoters” can also lead to “transcription” with
“signals the starting point for”. “Terminators” can also lead to “transcription” with
“signals the end point for”. Similarly, “stop codons” can lead to “translation” with “ends
the process of”. Finally, “Transcription factors” can lead to “Enhancers” with “bind to”.
3. How do transgenic organisms fit into this concept map?
“Transgenic organisms” could lead to “genetic code” with “have an artificially
modified”
4. Use the concept map to explain why a mutation in DNA sometimes causes protein
function to change. When a mutation occurs it can cause a change in the DNA sequence.
If the change in the DNA sequence leads to a change in the amino acid sequence that it
codes for there will be a change in the protein or a faulty protein could be produced.
Therefore, mutations could lead to change in protein structure which means a change in
protein function. If the mutation is neutral, the mutation codes for the same amino acid
sequence, there would be no change in protein function.