SUPPLEMENTAL METHODS.
Supplemental methods 1. PET analyses of HSV1-TK expression
The animals were fasted overnight before the PET study. On the day of the PET
imaging, anesthesia was initially induced with ketamine (0.1 mg/kg im, imalgene 1000,
Merial, France) and imidazolam (1.84 mg/kg im, Dormicum, Roche Farma, Spain) to
allow the transport of the animals to the PET Laboratory. Anesthesia during the scan
was maintained with ketamine (0.05 mg/kb, im) and imidazolam (0.92 mg/kg im).
Scans were performed in a small animal dedicated Mosaic PET scanner (Philips) with
an11.9 cm axial and 12.8 cm transaxial field of view (FOV). Dynamic and transmission
studies have been described[13]. 18F-FHBG was synthesized as reported and specific
accumulation of this radioactive tracer in the liver of treated macaques was measured as
previously reported[13].
Supplemental methods 2. FACS analysis
Total blood (100 L) was stained with anti-monkey CD3-APC (clone 1OD12,
Miltenyi), anti-human CD8-PeCy5 (clone OKT-8, BD Biosciences), anti-human CD19PE (clone J4.119, Beckman Coulter) and anti-human CD20-FITC (clone 2H7, BD
Biosciences) mAbs for 45 min a 4ºC. Monoclonal antibodies OKT-8, J4.119, and 2H7
had been reported to cross-react with cynomolgus lymphocytes. Human Beriglobine (10
g/mL) was added during stainings to avoid unspecific binding. At the end of the
labeling, red cells were lysed without previous washing by adding 1 mL of 1  BD
FACS Lysing solution (BD Biosciences) to each sample. After 5 min of incubation at
room temperature, cells were pelleted and washed once before acquisition on a
FACSCalibur cytometer (BD Biosciences). FACS data were analyzed using FlowJo
2
program (Tree Star, Inc). The percentages of B (CD19+CD20+), CD4 (CD3+CD8-) and
CD8 (CD3+CD8+) lymphocytes were referred to the total leukocyte population gated by
Forward-scatter (size) and Side-scatter (morphology).
To estimate the cell number/mL of peripheral blood of each lymphocyte population, we
applied the following formula: (% of a particular lymphocyte population)  (number of
total leucocytes per mL of blood) / 100. The number of total leukocytes per mL of
blood was determined by checking the total number of isolated leukocytes (purified and
counted as detailed below) to the starting peripheral blood volume.
Supplemental methods 3. Measurement of cellular immune responses against
adenoviral vector. Monkey leukocytes were purified from peripheral blood by
centrifugation through Ficoll-Hypaque (GE Healthcare) (20 min at 600 g and 20ºC).
Contaminating erythrocytes were lysed by treatment with ACK buffer (0.15M NH4CL,
10 mM KHCO3, 0.1mM Na2EDTA). The total number of isolated leukocytes was
determined by counting the cells in a Z2 Coulter Counter (Beckman Coulter).
In order to measure proliferation by methyl-3HThymidine incorporation, isolated
leukocytes were cultured at a concentration of 5 x 105 cells/mL with culture medium
alone X-vivo medium (BioWhittaker) supplemented with 2 mM glutamax (Invitrogen),
and 1% penicillin/streptomycin (Invitrogen) or culture medium containing serial
dilutions of adenovirus capsid protein from 10-0.01 g/mL. Six hours before the 72h of
culture, cells were pulsed with 1 Ci/well of tritiated thymidine and cultured again. At
the end of this labeling time cells were harvested and methyl-3HThymidine
incorporation was determined in a scintillantion counter (Topcount). Stimulation Index
(S.I.) was defined as the mean counts per minute (cpm) of the response of the antigenstimulated cells divided by the mean cpm of the response of cells cultured without
3
antigen. A mix of the phorbol ester 12-myristate- 13-acetate (PMA) (0.01 g/mL) and
ionomicine (1 g/mL) was used as a positive control to assess the ability of cells to
respond to mitogens. Viral capsids had been harvested from the upper band adenovirus
purifications after centrifugation at 25,000 rpms for 12h in a CsCl gradient
corresponding to 1.25 g/ml density.
To determine specific proliferation of CD8 and CD4 T cells, isolated leukocytes were
resuspended in PBS at a final concentration of 5-10 x 106 cells/mL and labeled with 5(and -6)-carboxyfluorescein diacetate succinimidyl ester (CFSE) (SIGMA) (1.25 M)
for 15 minutes at RT. CFSE-labelled cells were washed and subsequently resuspended
in fetal calf serum-supplemented medium RPMI-glutamax medium (Invitrogen)
supplemented with 10% FCS (Sigma) and 1% penicillin/streptomycin (Invitrogen) at a
concentration of 1 x 106 cells/mL in the absence or presence of adenovirus capsid
protein (5 g/mL). After 6 days of culture, cells were harvested, stained with antimonkey CD3-APC and anti-human CD8-PECy5 mAb in the presence of Beriglobine
and finally acquired on a FACSCalibur. Proliferation of CD8 and CD4 T cells was
assessed by CFSE dilution gating on CD3+CD8+ cells (CD8 T cells) and on CD3+CD8(CD4 T cells) respectively.
Supplemental methods 4. Western blot analysis of liver biopsies.
Twenty or fifty μg of protein were electrophoresed on a 12% SDS-PAGE and
transferred onto nitrocellulose membranes using an electroblot system (Biorad). The
membrane was incubated with a 1:300 dilution of the polyclonal rabbit anti-TK sera
(provided by Dr WC Summers, Yale University) and 1:400 dilution of anti-rabbit IgG
horseradish-peroxidase conjugate (Goat anti-rabbit, GH/P, Ref. 170-6515, Biorad).
Light emission after the addition of the western lightning chemiluminescence reagent
4
(NLE 101, Perkin Elmer) was measured using an ImageQuant RT ECL (Amersham
Biosciences).
Supplemental methods 5. Immunohistochemistry of liver biopsies.
Serial paraffin sections were prepared and antigen retrieval was performed for 20 min at
95 ºC in 0.01 M Tris-1 mM EDTA buffer (pH=9) in a Pascal pressure chamber (S2800,
Dako). Samples were stained using a polyclonal rabbit anti-TK serum (1:8000; provided
by Dr WC Summers, Yale University) or a monoclonal mouse anti-human CD68 (clone
KP1, Code No. F7135, Dako, 1:400). The secondary labelled antibodies used were goat
anti-rabbit (K4003, Dako) or goat anti-mouse (K1001, Dako). Peroxidase was
developed using DAB+ (K3468, Dako). Sections were lightly counterstained with
hematoxylin and mounted. Quantitation of TK+ cells by immunohistochemistry out of
5,000 counted cells per hepatic lobe from the indicated macaques. Morphology
distinguished hepatocytes from Kupffer cells and the distinction of TK+ cells was taken
into account.
Supplemental methods 6.
Construction of SFV-hisTK vector
An expression system based on a Semliki forerest virus vector was used. Plasmid
pSFVb1-2A has been previously described and was kindly provided by Dr. P.
Liljeström (Karolinska Institute, Stockholm) [27]. For the generation of pSFV-hisTK a
PCR fragment of 1.1 Kb containing the sequence of HSV-tk gene was amplified from
plasmid pSFV-enhTK, which had previously been generated by subcloning HSV-tk
gene from pMV60/tk (Peñuelas et al., 2005) into pSFV-b12A. Briefly, HSV-tk was
amplified
from
pSFV-TK
by
using
primers
5´-
TAATACCCGGGCACCACCACCACCACCACGCTTCGTACCCCGGCCATCAACA
5
C-3´
and
5´-TCCACCCGGGTCAGTTAGCCTCCCCCATCTCTCGGGCAAACG-3´
which hybridize with the 5´ and 3´ ends of the HSV-tk gene, respectively (in italics),
contain Xma I sites (in bold) and a sequence coding for 6 histidines (underlined)
preceding the beginning of HSV-tk sequence. This PCR fragment was digested with
Xma I and inserted into Xma I site in pSFVb1-2A, generating pSFV-hisTK.
Transfection of cells for TK production
Plasmid pSFV-hisTK was linearized by digestion with SpeI and transcribed in the
presence of cap analog (New England Biolabs, USA) by using SP6 polymerase
(Amersham-Pharmacia, USA-Sweden) as described [28]. In vitro synthesized RNAs
was transfected into BHK-21 cells by electroporation as described previously
(Liljestrom and Garoff, 1994). For TK production a total of 108 BHK-21 cells were
electroporated with SFV-hisTK RNA (25 μg of RNA for each 107 cells), and incubated
for 24h at 33º. Cells were washed twice with PBS and lysed in a total volume of 1 ml of
lysis buffer containing 50mM Tris-ClH pH 8, 500mM ClNa and Complete Protease
Inhibitor Cocktail (Roche, Germany). Purification from the lysates was performed in a
Fast Protein Liquid Chromatography with HitrapAffinity Columns (His-Trap FFC rude,
GEHealthcare) and imidazole gradient.