Analysis of microbial communities with QIIME Justin Kuczynski February 2012 Because Microbial communities are important Microbial communities are important Microbial communities are important Microbial communities are important photos: stockphoto.it, eurasnet.info, elkhorn.unl.edu One option: 16S / SSU sequence based profiling Focus on the ribosomal SSU / 16S gene Target and amplify the 16S/18S ribosomal RNA as a ‘fingerprint’ for different taxonomic groups. Why 16S/18S? - gene is ubiquitous - contains conserved and variable regions SSU / 16S experimental workflow Extract DNA and amplify marker gene with barcoded primers Pool amplicons and sequence Sequences are not directly interpretable line 12,000 of 1.2 M Sequences are not directly interpretable And beware: ▫ ▫ ▫ ▫ line 12,000 of 1.2 M chimeric PCR products sequencing error uneven sequencing depth short read effects From sequences to results From sequences to results E. Costello et al., 2009 That is QIIME’s purpose Extract DNA and amplify marker gene with barcoded primers >GCACCTGAGGACAGGCATGAGGAA… >GCACCTGAGGACAGGGGAGGAGGA… >TCACATGAACCTAGGCAGGACGAA… >CTACCGGAGGACAGGCATGAGGAT… >TCACATGAACCTAGGCAGGAGGAA… >GCACCTGAGGACACGCAGGACGAC… >CTACCGGAGGACAGGCAGGAGGAA… >CTACCGGAGGACACACAGGAGGAA… >GAACCTTCACATAGGCAGGAGGAT… >TCACATGAACCTAGGGGCAAGGAA… >GCACCTGAGGACAGGCAGGAGGAA… Assign reads to communities www.qiime.org Pool amplicons and sequence Assign millions of sequences from thousands of communities to OTUs Visualize and compare community relationships QIIME analysis in more detail QIIME analysis in more detail QIIME analysis in more detail beta_diversity_through_plots.py QIIME analysis example beta_diversity_through_plots.py QIIME analysis example QIIME analysis example QIIME analysis example Demo of beta diversity analysis results Demo of beta diversity analysis results QIIME tech support • www.qiime.org • Overview Tutorial • QIIME forum Running QIIME Laptop images: pcdownload.asia, ostatic.com EC2 Cluster Acknowledgements RESEARCH FUNDING Crohn’s and Colitis Foundation of America, the Bill and Melinda Gates Foundation, NASA, the HHMI and the NIH justinak@gmail.com www.qiime.org Antonio González Bharath Prithiviraj Catherine Lozupone Chris Lauber Dan Knights Daniel McDonald Donna Berg-Lyons Doug Wendel Greg Caporaso Jens Reeder Jerry Kennedy Jess Metcalf Jesse Stombaugh Jesse Zaneveld José Clemente Justin Kuczynski Laura Parfrey Meg Pirrung Rob Knight Tony Walters Ulla Westermann Will Van Trueren