Personalized Med presentation - Michael D. Kane, Ph.D.

advertisement
Pharmacogenomics and Personalized Medicine
Michael D. Kane, PhD
Associate Professor, University Faculty Scholar, Graduate Education Chair
Department of Computer and Information Technology
College of Technology
&
Lead Genomic Scientist, Bindley Bioscience Center at Discovery Park
Purdue University
West Lafayette, Indiana 47907
bioinformatics.tech.purdue.edu
Current Industry Positions:
Co-Founder: Genomic Guidance, LLC (Personalized Medicine, Information Management)
Co-Founder: Broadband Antenna Tracking Systems, Inc (Wireless Communications Technology)
Former Industry Positions:
Co-Founder & President: Nucleico, LLC (Gene Expression Profiling, Microarrays)
VP of R&D: Genomic Solutions, Inc (Biotechnology Instrumentation and Software, Microarrays)
Senior Scientist: Pfizer Pharmaceuticals (Molecular Technologies Group)
Scientific Advisor and Co-Inventor: Sensigen Diagnostics (Clinical HPV Detection)
Bioinformatics & Genomics
From Genetics to Data Management Systems…
>gi|1924939|emb|X98411.1|HSMYOSIE Homo sapiens partial mRNA for myosin-IF
CAGGAGAAGCTGACCAGCCGCAAGATGGACAGCCGCTGGGGCGGGCGCAGCGAGTCCATCAATGTGACCC
TCAACGTGGAGCAGGCAGCCTACACCCGTGATGCCCTGGCCAAGGGGCTCTATGCCCGCCTCTTCGACTT
CCTCGTGGAGGCCATCAACCGTGCTATGCAGAAACCCCAGGAAGAGTACAGCATCGGTGTGCTGGACATT
TACGGCTTCGAGATCTTCCAGAAAAATGGCTTCGAGCAGTTTTGCATCAACTTCGTCAATGAGAAGCTGC
AGCAAATCTTTATCGAACTTACCCTGAAGGCCGAGCAGGAGGAGTATGTGCAGGAAGGCATCCGCTGGAC
TCCAATCCAGTACTTCAACAACAAGGTCGTCTGTGACCTCATCGAAAACAAGCTGAGCCCCCCAGGCATC
ATGAGCGTCTTGGACGACGTGTGCGCCACCATGCACGCCACGGGCGGGGGAGCAGACCAGACACTGCTGC
AGAAGCTGCAGGCGGCTGTGGGGACCCACGAGCATTTCAACAGCTGGAGCGCCGGCTTCGTCATCCACCA
CTACGCTGGCAAGGTCTCCTACGACGTCAGCGGCTTCTGCGAGAGGAACCGAGACGTTCTCTTCTCCGAC
CTCATAGAGCTGATGCAGTCCAGTGACCAGGCCTTCCTCCGGATGCTCTTCCCCGAGAAGCTGGATGGAG
ACAAGAAGGGGCGCCCCAGCACCGCCGGCTCCAAGATCAAGAAACAAGCCAACGACCTGGTGGCCACACT
GATGAGGTGCACACCCCACTACATCCGCTGCATCAAACCCAACGAGACCAAGCACGCCCGAGACTGGGAG
GAGAACAGAGTCCAGCACCAGGTGGAATACCTGGGCCTGAAGGAAAACATCAGGGTGCGCAGAGCCGGCT
TCGCCTACCGCCGCCAGTTCGCCAAATTCCTGCAGAGGTATGCCATTCTGACCCCCGAGACGTGGCCGCG
GTGGCGTGGGGACGAACGCCAGGGCGTCCAGCACCTGCTTCGGGCGGTCAACATGGAGCCCGACCAGTAC
CAGATGGGGAGCACCAAGGTCTTTGTCAAGAACCCAGAGTCGCTTTTCCTCCTGGAGGAGGTGCGAGAGC
GAAAGTTCGATGGCTTTGCCCGAACCATCCAGAAGGCCTGGCGGCGCCACGTGGCTGTCCGGAAGTACGA
GGAGATGCGGGAGGAAGCTTCCAACATCCTGCTGAACAAGAAGGAGCGGAGGCGCAACAGCATCAATCGG
AACTTCGTCGGGGACTACCTGGGGCTGGAGGAGCGGCCCGAGCTGCGTCAGTTCCTGGGCAAGAAGGAGC
GGGTGGACTTCGCCGATTCGGTCACCAAGTACGACCGCCGCTTCAAGCCCATCAAGCGGGACTTGATCCT
GACGCCCAAGTGTGTGTATGTGATTGGGCGAGAGAAGATGAAGAAGGGACCTGAGAAAGGTCCAGTGTGT
GAAATCTTGAAGAAGAAATTGGACATCCAGGCTCTGCGGGGGGTCTCCCTCAGCACGCGACAGGACGACT
TCTTCATCCTCCAAGAGGATGCCGCCGACAGCTTCCTGGAGAGCGTCTTCAAGACCGAGTTTGTCAGCCT
TCTGTGCAAGCGCTTCGAGGAGGCGACGCGGAGGCCCCTGCCCCTCACCTTCAGCGACACACTACAGTTT
CGGGTGAAGAAGGAGGGCTGGGGCGGTGGCGGCACCCGCAGCGTCACCTTCTCCCGCGGCTTCGGCGACT
TGGCAGTGCTCAAGGTTGGCGGTCGGACCCTCACGGTCAGCGTGGGCGATGGGCTGCCCAAGAACTCCAA
GCCTACCGGAAAGGGATTGGCCAAGGGTAAACCTCGGAGGTCGTCCCAAGCCCCTACCCGGGCGGCCCCT
GGCGCCCCCCAAGGCATGGATCGAAATGGGGCCCCCCTCTGCCCACAGGGGG
Year
GenBank Data
Base Pairs
Sequences
1982
680,338
606
1983
2,274,029
2,427
1984
3,368,765
4,175
1985
5,204,420
5,700
1986
9,615,371
9,978
1987
15,514,776
14,584
1988
23,800,000
20,579
1989
34,762,585
28,791
1990
49,179,285
39,533
1991
71,947,426
55,627
1992
101,008,486
78,608
1993
157,152,442
143,492
1994
217,102,462
215,273
1995
384,939,485
555,694
1996
651,972,984
1,021,211
1997
1,160,300,687
1,765,847
1998
2,008,761,784
2,837,897
1999
3,841,163,011
4,864,570
2000
11,101,066,288
10,106,023
2001
15,849,921,438
14,976,310
2002
28,507,990,166
22,318,883
2003
36,553,368,485
30,968,418
2004
44,575,745,176
40,604,319
2005
56,037,734,462
52,016,762
2006
69,019,290,705
64,893,747
2007
83,874,179,730
80,388,382
2008
99,116,431,942
98,868,465
Bioinformatics & Genomics
Biomolecular Trends:
Yeast Genome
1.2 x 107 BP
(1/275x Human)
Human Genome
3.3 x 109 BP
(1x)
Onion Genome
15 x 109 BP
(5x Human)
Lily Genome
90 x 109 BP
(27x Human)
Introduction to PharmacoGenomics
Single Nucleotide Polymorphisms (SNPs) are simple changes (or differences) in the DNA sequence
that appear to have little or no impact on human health. They represent 90% of all human genetic
variations.
Genetically similar to a mutation, but distinct in that a SNP is not causal to a clinical disease or
disorder (or at least not yet causally linked, and not really applicable to ages >40 yrs old).
Across the human genome we average approximately 1 SNP for every 300 base pairs of DNA (over
one million known SNPs that occur at a frequency of 1% or higher in the world population).
Important Consideration: Inheritance
The appearance of deleterious mutations during evolution tend to NOT be inherited for obvious
reasons, at least those that affect growth, reproduction and viability.
…and our modern existence is the result of millions of years of tolerated (and occasionally
beneficial) changes in our genome, which is most often evident in what we can and cannot eat or
consume (think: evolutionary pressure & natural selection)
Monomethyl Hydrazine (in “False” Morel Mushrooms)
(many examples of “toxins” in nature, many of them
are presumably synthesized to prevent consumption
or predation of the host plant or organism)
Tylenol: Acetaminophen (Cats?)
Modern drug discovery & development falls outside the
tolerances & toxicity that have resulted from evolution,
because most of these compounds have NEVER been seen in
nature.
Adverse Drug Reactions
More than 770,000 patients die or sustain serious injury every year
in the U.S. from Adverse Drug Reactions (ADRs).
ADRs are therefore the 4th leading cause of death in the United
States and are one of the leading, preventable public health issues
today.
ADRs cost each hospital approximately $5.6 million per year.
In terms of total health care dollars, ADRs cost the U.S. health care
system between $1.5 and $5.4 billion per year.
SNPs have been purposed to account for 24% of all ADRs.
The Pharmacogenomics of Warfarin
When you ingest a drug, the drug is absorbed into the circulatory system and is distributed
throughout the body.
The drug is then available to carry out its intended ‘mechanism of action’ (MOA). In the case
of WARFARIN, it inhibits Vitamin K Epoxide Reductase Complex 1 (VKORC1), and reduces
blood clotting. It is the largest selling anticoagulant in the world, and the leading case in
support of Personalized Medicine”.
Subsequently, the body has the ability to eliminate the drug from the body through “drug
metabolism”, which is primarily carried out in the liver. WARFARIN is metabolized primarily
by the oxidative liver enzyme CYP2C9, which basically adds an oxygen group to the
WARFARIN structure thereby inactivating its MOA and increasing its likelihood of elimination
from the body via the kidneys (urine).
For this reason, drug tests that utilize urine a sample source often look for the “metabolite”
of the drug in the urine, rather than the ingested drug.
IMPORTANT: If you are prescribed WARFARIN, you have a condition that generates
potentially life-threatening blood clots. If you are dosed with too much WARFARIN you could
die from complications due to internal bleeding, yet if you are dosed with too little
WARFARIN you may be in danger of serious consequences due to circulating embolism.
Go to www.genescription.com
Genescription is a free, online
training program in Personalized
Medicine for instructors and
healthcare professionals.
(developed through a grant from Microsoft External Research)
Examples of Clinically-Relevant SNPs
From: Kane, et al. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine.
Personalized Medicine 5(4): 387-397 (2008)
Evidence suggests that Healthcare will be a primary influence on
the US economy for the next 50 years.
The “Workforce 2015: Strategy Trumps Shortage” describes how
hospitals face the overlapping challenges of attracting and retaining
replacements for retiring workers, expanding its workforce to care
for an aging population, the greater demand for information
technology professionals while coping with significant changes in
healthcare delivery.
The “Global Healthcare Information Technology (2009 - 2014)”
report states that the current healthcare information technology
market is estimated to be $53.8 billion.
Where do YOU see professional, commercial, and entrepreneurial
opportunities in this emerging area of healthcare?
Clinical Genotyping Workflow in Healthcare
From: Kane, et al. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine.
Personalized Medicine 5(4): 387-397 (2008)
Clinical Genotyping Workflow in Healthcare
From: Kane, et al. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine.
Personalized Medicine 5(4): 387-397 (2008)
Considerations for Clinical Genotyping Data Management and User
Interface Design and Content in Healthcare
From: Kane, et al. Drug Safety Assurance through Clinical Genotyping: Near-Term Considerations for a System-Wide Implementation of Personalized Medicine.
Personalized Medicine 5(4): 387-397 (2008)
QUESTIONS?
Download
Related flashcards

Population genetics

22 cards

Population genetics

25 cards

Mitochondrial diseases

16 cards

Nucleobases

21 cards

Genes

38 cards

Create Flashcards