Chapter 17 - From Gene to Protein Now that we know how the genetic design information that codes for all the RNA/proteins necessary to build/maintain organisms is replicated so that it can be passed from cell to cell, organism to organism or even virus to virus…what is the next question? Chapter 17 - From Gene to Protein The next question concerns how DNA… 1. …is replicated during S phase so that the information it encodes needed to build/maintain organisms can be passed to the next generation. 2. …stores this information that will be used to make all the RNA/polypeptides that will directly build/maintain the organism. molecular biology- the study of biology at the molecular level (overlaps biochemistry and genetics in particular). Much of what we have done thus far is molecular biology – cell resp, photosyn, membrane transport, endomembrane system, central dogma, etc… Mendelian genetics is not because you never discuss the molecular level, but chromosomal genetics is. Chapter 17 - From Gene to Protein Your cells need “workers”. We have discussed many of these workers in detail at this point: glycolysis enzymes, krebs enzymes, ETC transporters, cytoskeleton, antibodies, insulin, carbonic anhydrase, hemoglobin, glucose transporter, Calvin enzymes, Photosystems, kinesin, Various receptors, signal transduction proteins, tRNA, ribosomes, photosystems, and the list goes on… What determines the structure/function of a protein/RNA? The sequence. What determines the sequence? The DNA (gene) sequence. What determines your DNA sequence? Your parents DNA sequence and the changes (mutations) that might have occurred between them and you… Chapter 17 - From Gene to Protein NEW AIM: How is genetic information transmitted from DNA to protein? How is the genetic information transmitted from DNA to protein? Fig. 10.6A ? Chapter 17 - From Gene to Protein NEW AIM: How is genetic information transmitted from DNA to protein? What did we call this process? Fig. 10.6A ? Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? The Central Dogma of Molecular Biology Fig. 10.6A ? What is the first step and what enzyme is involved? Chapter 17 - From Gene to Protein NEW AIM: How is genetic information transmitted from DNA to protein? The Central Dogma of Molecular Biology By RNA polymerase …and the second step? Transcribe means to make a written copy. mRNA is a copy of a segment of DNA, a gene. They are the same language – nucleic acid language. Chapter 17 - From Gene to Protein NEW AIM: How is genetic information transmitted from DNA to protein? The Central Dogma of Molecular Biology By the ribosome and tRNAs Translate means to convert between languages. In this case, nucleic acid language is translated into amino acid language by the ribosome and tRNA. Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? The Central Dogma of Molecular Biology Reminder (analogy): The nucleus is the library, the DNA/chromosomes are the reference books that cannot leave the library, and the mRNA is the transcription or copy of a small part of the DNA, a gene, that is slipped through the nuclear pore to a ribosome (rRNA + proteins) in the cytosol that will be involved in translating the nucleic acid language into amino acid language (a polypeptide) with the help of tRNA. Do bacteria have a library? They do not have a nucleus…transcription occurs in the semifluid Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Fig. 10.7 Reminder: A single chromosome has thousands of genes… Each gene codes for? A complementary piece of RNA (mRNA, tRNA or rRNA) If the gene codes for mRNA, then the mRNA will code for?A polypeptide Quaternary If the polypeptide is functional all by itself (no __________ structure), it is a…? Protein Chapter 17 - From Gene to Protein NEW AIM: How is genetic information transmitted from DNA to protein? The Central Dogma of Molecular Biology Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? 1. TRANSCRIPTION (The Basics) You be RNA polymerase and transcribe the above piece of DNA… Fig. 10.8B Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? 1. TRANSCRIPTION (The Basics) PROBLEM: DNA has two strands. RNA polymerase only transcribes one strand into RNA… Which one? - That depends on the gene. The same strand will always be transcribed by RNA polymerase for a given gene. Fig. 10.8B Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? 1. TRANSCRIPTION (The Basics) 3’ 5’ 5’ 3’ In this example, it is the top strand that will be transcribed. Transcribe it… Fig. 10.8B Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? 1. TRANSCRIPTION (The Basics) 3’ 5’ SEEING DOUBLE: RNA polymerase will bind to the DNA, open up the strands (using ATP of course) and random RNA nucleotides (triphosphates) will bounce in and out of the active site until the complementary one bounces in and sticks long enough for the condensation reaction to occur forming a phosphodiester linkage. Which DNA strand doeslike the the transcribed strand look like? with U The RNA transcript will look non-transcribed strand 5’ 3’ Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? 1. TRANSCRIPTION (The Basics) Template/antisense or non-coding stran The transcribed strand is also called the: 1. Template Strand 2. anti-sense strand 3. non-coding strand Sense or coding strand The reason for number one is obvious, but the other two are not...these are named this way because: The other DNA strand is called the: 1. Sense strand 2. Coding strand Why? Because the sequence of this strand matches Fig. 10.8B the RNA with U for T of course. Therefore, this DNA strand makes sense because it matches the RNA. Also, the RNA carries the CODE and therefore the Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? 1. TRANSCRIPTION (The Basics) 3’ 5’ Template/antisense or non-coding stran RNA polymerase is similar to DNA polymerase in that: It can only synthesize RNA from the 5’ to 3’ end… How would you label the DNA in this case? You label the sense strand the same way the RNA transcript is labeled and the complementary strand that RNA polymerase used to make the transcript must be antiparallel… 5’ 5’ 3’ Sense or coding strand 3’ Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question 1: Write out the transcript of the following gene from 5’ to 3’ if the top strand is the sense strand. 3’ 5’ ATAGCGGCTATTA 3’ 5’TATCGCCGATAAT ANS: 5’ AUUAUCGGCGAUA 3’the template strand is the opposite If the top strand is the sense strand then strand or the bottom one. RNA polymerase can only make RNA 5’ to 3’ and therefore must start on the right and work toward the left looking at the bottom strand. You could also reason that the top is the sense and the transcript must read just like the sense from 5’ to 3’. Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question 2: Write out the transcript of the following gene from 5’ to 3’ if the bottom strand is the antisense (non-coding) strand. 5’ 3’ ATAGCGGCTATTA 5’ 3’TATCGCCGATAAT ANS: 5’ AUAGCGGCUAUUA3’ Since the bottom strand is the non-coding strand or antisense strand, this is the template. RNA polymerase looks at this one and adds the complementary bases starting at the 3’ end since it can only make RNA 5’ to 3’. Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question 3: Write out the transcript of the following gene from 5’ to 3’ if the bottom strand is the sense (coding) strand. 5’ 3’ ATAGCGGCTATTA 5’ 3’TATCGCCGATAAT ANS: 5’ UAAUAGCCGCUAU 3’ (sense strand), the top one is the Since the bottom strand is the coding strand template. RNA polymerase looks at the top strand and adds the complementary bases starting at the 3’ end since it can only make RNA 5’ to 3’. Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question 4: RNA polymerase makes the following transcript: RNA Transcript: 5’ AUCGCGGUUACGG 3’ Draw out the piece of DNA corresponding to this transcript: 3’ 5’ ATCGCGGTTACGG 5’ 3’ TAGCGCCAATGCC You are given the transcript. There are a few ways to do this. I prefer thinking from the perspective of RNA polymerase. Since this is what it made, it must have looked at the complementary DNA strand going from 3’ to 5’, which I wrote as the bottom strand here. I then filled in the complementary DNA strand above it to complete the double stranded DNA molecule. DNA is always written with the 5’ end of one strand on the top Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question 5: RNA polymerase makes the following transcript: RNA Transcript: 3’ AUCCGGCGAUUUCG 5’ to this transcript: Draw out the piece of DNA corresponding RNA Transcript (flipped over): GCUUUAGCGGCCUA 3’ 5’ 3’ 5’ GCTTTAGCGGCCTA 5’ 3’ CGAAATCGCCGGAT I will always write out the RNA transcript from 5’ to 3’ because this is how it is made and that is what makes sense to me. Then you finish it the same way as the previous one… Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question 6: You send in a segment of a gene to the DNA sequencing facility. They return the following sequence to you: 3’ 5’ GCAACTTCGCCATTAG This is the sense strand. What would the RNA transcript be? RNA Transcript: 5’ GCAACUUCGCCAUUAG 3’ It would be the same as the sense strand with U substituted for T. AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION (the details) What parts of your genome (DNA/chromosomes) do RNA polymerases Thetranscribe? 30,000+ Genes How do the enzymes (RNA polymerases) “know” where the genes start and where they stop??? AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION (some details) a single gene We only need to look at how this works at a single gene as the process is similar for all of them. AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION (some details) Let’s put this into some realistic context. Let’s imagine we are in the nucleus of a beta cell of your pancreas, which are the ones that secrete insulin when your blood glucose levels get too high (>140mg/dl). They need to be ready at any moment in case you drink a soda… and thus the gene is typically active and insulin is being made and packed into vesicles via the endomembrane system. The vesicles sit and wait for glucose to bind a receptor on the membrane followed by signal transduction, which will trigger the vesicles to fuse with the membrane and thus release the insulin into the blood. Let’s watch the mRNA being transcribed for the insulin gene… Fig. 10.9B AIM: How is genetic information transmitted from DNA to Protein? (Transcription Unit) Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION Basic Anatomy of a Gene: 1. The Promoter – a sequence of DNA that RNA polymerase will bind (“stick”) to indirectly with the help of other proteins called transcription factors in order to begina.transcription video). In prokaryotes the(see consensus sequence is TATAAT and is called the Pribnow box b. In eukaryotes the consensus sequence is TATAAA and is called the TATA box 2. The Transcription Unit – the part that is transcribed into RNA (promoter and terminator are not transcribed) 3. The Terminator – sequence of DNA that will cause RNA polymerase to stop and fall off the DNA Fig. 10.9B AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION Let’s watch a video to see how these parts of the gene, RNA polymerase, a bunch of special protein called transcription factors and of course…ATP, come together to make transcription possible. AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION of the gene has 3 general stages: A. Initiation i. RNA polymerase and general TFs bind to promoter region ii. DNA unwinds and transcription begins (requires ATP) iii. The Promoter sequence “tells” RNA polymerase which strand of DNA to transcribe Fig. 10.9B 3’ 5’ 5’ 3’ AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION of the gene has 3 general stages: A. Initiation iv. Transcription factors - Additional proteins required for RNA polymerase to start transcription. - We have spoken many times about such factors being phosphorylated in the cytoplasm via signal transduction resulting in their export into the nucleus. ASIDE: ATP does NOT REDUCE anything, it phosphorylates. Fig. 10.9B AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION of the gene has 3 general stages: A. Initiation More Detail: Don’t memorize this level of detail unless you have nothing else to do. First email me though and I will find you something else to do. Fig. 10.9B AIM: How is genetic information transmitted from DNA to Protein? Fig. 10.9B Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION (3 stages) B. Elongation i. RNA polymerase polymerizes complementary RNA nucleotides across from the template/anti-sense/noncoding strand., which is always the same in a gene and is determined by the promoter. sense strand coding strand 3’ 5’ 5’ 3’ 5’ anti-sense strand 5’ AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION (3 stages) B. Elongation ii. Just like DNA polymerase, where does RNA polymerase get the energy to link together RNA nucleotides? A. From the nucleotides themselves: they are all triphosphates (ATP, GTP, UTP, CTP) and have a higher affinity for each other than for the they are attached iii.diphosphate Rate: to… ~60 nucleotides per second Fig. 10.9B 5’ AIM: How is genetic information transmitted from DNA to Protein? Central Dogma (DNA to polypeptide) 1. TRANSCRIPTION (3 stages) C. Termination i. RNA polymerase reaches a sequence in the gene that causes it to fall off, releasing the completed RNA transcript. Fig. 10.9B NEW AIM: How is genetic information transmitted from DNA to Protein? RNA polymerase making RNA (the red strand) AIM: How is genetic information transmitted from DNA to Protein? What might be the evolutionary advantage of having a nucleus? After all, bacteria do not have nuclei and they make RNA and polypeptides from their chromosome similar to eukaryotes… Part of the answer might lie in RNA PROCESSING By separating the initial RNA transcript from the ribosomes in the cytoplasm, “workers” are able to modify the RNA in various ways…it is all about compartmentalization… AIM: How is genetic information transmitted from DNA to Protein? RNA PROCESSING (eukaryotes ONLY) By separating the initial RNA transcript from the ribosomes in the cytoplasm, “workers” are able to modify the RNA in various ways…it is all about compartmentalization… 1. Adding the 5’ cap and the poly A (adenosine) tail NEW AIM: How is genetic information transmitted from DNA to Protein? RNA Processing (eukaryotes) – the 5’ cap and poly A tail NEW AIM: How is genetic information transmitted from DNA to Protein? 7-methyl-guanosine CAP AIM: How is genetic information transmitted from DNA to Protein? RNA PROCESSING (eukaryotes ONLY) 1. Adding the 5’ cap and the poly A (adenosine) FUNCTION? tail A. Both appear to be required for nuclear export. B. Both protect the mRNA from hydrolysis in the cytoplasm by nucleases known as RNAses. C. The cap and tail assist the ribosome to bind 2. RNA Splicing NEW AIM: How is genetic information transmitted from DNA to Protein? 2. RNA Splicing More detailed Anatomy of a Eukaryotic Gene: i. - Transcription unit of eukaryotes is broken into exons and introns. - The introns are named because they are “intervening” sequences. - Both the exons and introns are transcribed as shown, but… Fig. 10.10 NEW AIM: How is genetic information transmitted from DNA to Protein? 2. RNA Splicing ii. Introns are removed from the mRNA and the exons are SPLICED together by the spliceosome. -some = body iii. Spliceosomes are RNA and protein complexes…(what other complex is composed of RNA and protein, and is active between DNA and protein in the central dogma also supporting the RNA world The ribosome hypothesis?) Why do splicing??? Fig. 10.10 NEW AIM: How is genetic information transmitted from DNA to Protein? 2. RNA Splicing What is the spliceosome composed of? SnRNPs (“snurps”) 1. SnRNP = Small nuclear ribonucleoproteins (Small RNA/protein complexes in the nucleus) 2. Composed of a core snRNA molecule of ~150 nucleotides with associated proteins 3. Assorted SnRNPs combine to form the spliceosome Aside: Ribozymes are true RNA enzymes. Certain species have introns that splice themselves out (catalyze their own removal without help from a spliceosome). These are ribozymes. Chapter 18 - Genetics of Viruses and Bacteria Questions 1. RNA polymerase binds to __________________, which in turn bind to each other and the promoter in order to begin transcription. 2. The eukaryotic promotor is known as the _____________, while the prokaryotic promotor is the _______________. 3. Transcribe the following gene segment and write out the corresponding RNA sequence from 5’ to 3’: ATGGCCGGCTATTAAGCGAC 4. Identify the three general components of any gene. 5. One function of the 5’cap and 3’ tail is to protect the mRNA from _____________ in the cytosol. NEW AIM: How is genetic information transmitted from DNA to Protein? Let’s look at a little history first… Beadle and Tatum (1941) In 1941, American geneticists Beadle and Tatum proposed the “one gene, one enzyme” hypothesis, which states that each gene codes for an enzyme NEW AIM: How is genetic information transmitted from DNA to Protein? Beadle and Tatum (1941) NEW AIM: How is genetic information transmitted from DNA to Protein? Let’s look at a little history first… The hypothesis was later modified to the “one gene, one protein” hypothesis… It was again modified to the “one gene, one polypeptide” hypothesis… (you should know why) Getting closer and closer to the truth, but even this hypothesis is not always correct… because of ALTERNATIVE SPLICING AIM: How is genetic information transmitted from DNA to Protein? ALTERNATIVE SPLICING Exons can be spliced together in different ways leading to different proteins/polypeptides being formed from the gene… Thissame may be one reason why splicing evolved – you can get more than one polypeptide per gene (not all genes do this). AIM: How is genetic information transmitted from DNA to Protein? Exon Shuffling NEW AIM: How is genetic information transmitted from DNA to Protein? RNA Splicing NEW AIM: How is genetic information transmitted from DNA to Protein? The Final Mature mRNA: UTR – untranslated region (guess why it is called this?) AIM: How is genetic information transmitted from DNA to Protein? Transcription and RNA Processing Summary 1. RNA pol binds near promoter with help of transcription factors. ATP required to start transcription. 2. Transcription of the transcriptional unit begins. RNA pol moves along and puts complementary RNA nucleotides across from bases of the template/anti-sense/non-coding strand building the transcript from 5’ to 3’. Energy comes from the nucleotides themselves (they are NTPs – nucleotide = ATP, CTP, GTP, UTP) and falls off. 3. RNA pol triphosphates reaches the terminator DNA sequence 4. A 5’ cap and poly A tail is added if it is mRNA (as opposed to tRNA or rRNA) 5. Introns are spliced out and exons spliced together by the spliceosome resulting in the mature mRNA. 6. mRNA leaves nucleus through nuclear pore Reminder: Transcription is similar for prokaryotes and eukaryotes with the exception of where it happens (in the nucleus in eukaryotes), but RNA processing happens in eukaryotes only NEW AIM: How is genetic information transmitted from DNA to Protein? Fig. 10.6A Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Cracking the Genetic (Translating DNA/RNA Language Code into amino acid language) Genetic Code: The rules by which information is encoded in DNA/mRNA and translated into polypeptide sequences. The chromosomes are books, which would make a gene just one sentence in these books… Chromosomes = Books Gene = Sentence in the Book RNA = A copy of the sentence 5’ What does the “sentence” say? 3’ Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Cracking the Genetic (Translating DNA/RNA Language Code into amino acid language) All English books are written using 26 letters arranged into different combinations to make words, which are combined to make sentences... RNA Nucleic Acid Language is MUCH simpler… Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Cracking the Genetic (Translating DNA/RNA Language Code into amino acid language) RNA Nucleic Acid Language is MUCH simpler… 1. There are only 4 letters (A,U,G,C) 2. These letters combine to make “words”, called codons, which are only 3 letters long. 5’ 3’ Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Cracking the Genetic (Translating DNA/RNA Language Code into amino acid language) RNA Nucleic Acid Language is MUCH simpler… 1. There are only 4 letters (A,U,G,C) 2. These letters combine to make “words”, called codons, which are only 3 letters long. How many different codons can be made from the four letters? 4 x 4 x4 = 64 5’ 3’ *Only 64 words in the entire language!! (It could not be any simpler and still work) Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Cracking the Genetic (Deciphering DNA/RNA Code Language) What do these 64 codons code for? 1. Sixty-One of the codons code for an amino acid 5’ 3’ Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Cracking the Genetic (Deciphering DNA/RNA Code Language) What do these 64 codons code for? 1. Sixty-One of the codons code for an amino acid Example: The codon AUG codes for the amino acid Methionine (Met) – this is typically the first or starting codon, whichMethionine makes __________ the first amino acid of most proteins 5’ 3’ Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Cracking the Genetic (Deciphering DNA/RNA Code Language) What do these 64 codons code for? 1. Sixty-One of the codons code for an amino acid This is not the actual start of the mRNA, just the start of the transcription unit (TU) This is not the actual end of the mRNA, just the end of the TU Example: The codon AUG codes for the amino acid Methionine (Met) – this is typically the first or starting 5’ codon, whichMethionine makes __________ the first amino acid Label the two of most proteins ends of this 2. Three of the codons tell polypeptide: the ribosome to stop – C N UAG, UAA, UGA In reality, genes are thousands of bases pairs long as are mature mRNA’s leading to polypeptides that range from 50 to 1000’s of amino acids 3’ NEW AIM: How is genetic information transmitted from DNA to Protein? The genetic code was cracked in the 1960’s, just after the structure of DNA was elucidated. The chart to the right is used to look up any RNA codon and determine the amino acid it codes for… Fig. 10.8A The Genetic Code NEW AIM: How is genetic information transmitted from DNA to Protein? There are Sixty-One codons coding for amino acids, but there are only how many amino acids? 20 What does that mean? Some amino acids are coded for by more than one codon like Leu, which is coded for by 6 codons (built in redundancy)! Fig. 10.8A The Genetic Code Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question: Translate the mRNA sequence below - 5’ GCGGGCAUAAUCGCAUGCCAUUUACGGGCAACUACUUUAAGCGGUAGU STEP1: Find the first AUG (start codon). This is LIKELY the start of the coding r 5’ GCGGGCAUAAUCGCAUGCCAUUUACGGGCAACUACUUUAAGCGGUAGU STEP2: Break it into codons if you like after the AUG… 5’ GCGGGCAUAAUCGC-AUG-CCA-UUU-ACG-GGC-AAC-UAC-UUU-AAG-CGG-UAG-UUU- STEP3: Use the genetic code and translate it… Met-Pro-Phe-Thr-Gly-Asn-Tyr-Phe-Lys-Arg Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question: What is the mRNA sequence for the following polypeptide? Met-Pro-Leu-Leu-Gly-Asn-Asp-Gly-Gly You cannot know for sure since many of these amino acids can be coded for by more than one codon… Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question: A protein is 100 amino acids long. What would be the number of nucleotides in a mRNA coding region needed to code for all these amino acids? 303 base pairs (3 per amino acid and 3 for a stop) NEW AIM: How is genetic information transmitted from DNA to Protein? Translation (mRNA to polypeptide) – the details AIM: How is genetic information transmitted from DNA to Protein? 5’ 3’ Fig. 10.11B Let’s start with tRNA 1. tRNA carries amino acids to the ribosome 2. Each of the 20 amino acids is carried by a DIFFERENT tRNA 3. The anticodon of the tRNA complementary basepairs with the codon of th NEW AIM: How is genetic information transmitted from DNA to Protein? How are the amino acids added to tRNA molecules? Aminoacyl-tRNA synthetases (blue) 1. Enzymes that load the correct amino acid on the correct tRNA 2. Requires ATP (endergonic) tRNA’s are loaded like loading a gun. The amino acid wants to “shoot off” the tRNA (similar to the phosphate of ATP wanting to shoot off). Where will it be allowed to To an amino acid in a growing “shoot off” to? polypeptide chain within the ribosome. Let’s see how this works… NEW AIM: How is genetic information transmitted from DNA to Protein? How are the amino acids added to tRNA molecules? Aminoacyl-tRNA synthetases (blue) 1. Specific amino acid like methionine, and ATP bind active site. 2. ATP loses pyrophosphate and binds to amino acid as AMP – known as adenylation (amino acid now has energy – wants to jump off). 3. Appropriate tRNA enters active site –anticodon specifically binds to enzyme. 4. Amino acid transfers from AMP to tRNA forming aa-tRNA (aminoacyltRNA). It still has energy as the tRNA has a low affinity for the amino acid, just higher than AMP. NEW AIM: How is genetic information transmitted from DNA to Protein? How many different aa-tRNA synthetases are there? 20, one type for each amino acid… (With confused look on face): Hold up, there are 61 amino acid coding codons though and therefore 61 different tRNA’s!! How are there only 20 synthetases? These enzymes have evolved to be able to bind more than one type of tRNA… Let me really blow your mind… There are only ~45 different tRNA’s. Some can recognize more than one codon…the wobble base pair as proposed by Crick in 1966. I thought only weebles wabble! NEW AIM: How is genetic information transmitted from DNA to Protein? Inosine??? What’s an inosine??? NEW AIM: How is genetic information transmitted from DNA to Protein? Inosine (a purine) And you thought there were only 4 different bases in RNA…lol!! NEW AIM: How is genetic information transmitted from DNA to Protein? ? Which amino acid will be added to this tRNA? ALWAYS Alanine (Ala) NEW AIM:17 How is genetic Chapter - From Geneinformation to Proteintransmitted from DNA to Protein? AIM: How is genetic information transmitted from DNA to protein? Identify the amino acid found on a tRNA with the anticodon 3’-GCC-5’. 1. The codon on the mRNA would be 5’CGG-3’ 2. Look this codon up 3. The amino acid attached to this tRNA if Arginine (Arg) The amino acid proline is bound to a tRNA. What could the anticodon of this tRNA be? The codons for proline (5’ to 3’) are: CCU, CCC, CCA and CCG The anticodon (3’ to 5’) could then be: GGA, GGG, GGU or GGC NEW AIM: How is genetic information transmitted from DNA to Protein? 5’ 3’ 5’ C U A 3’ Which amino acid will be added to this tRNA (careful)? Aspartate (Asp) Remember that the mRNA is read 5’ to 3’ by the ribosomes. Therefore the tRNA will bind antiparallel 3’ CUA 5’ and the codon will be 5’ GAU 3’. AIM: How is genetic information transmitted from DNA to Protein? Fig. 10.13A Translation (the details): Broken up into 3 stages just like transcription 1. Initiation 2. Elongation 3. Termination It all begins when the mRNA leaves the nucleus and is in the AIM: How is genetic information transmitted from DNA to Protein? STAGE 1: Initiation 1. The small subunit of the ribosome binds to a specific nucleotide sequence in the mRNA upstream of the start codon with the help of the cap. It will make its way to the start codon (AUG). The initiator tRNA (the first or starting tRNA) carrying methionine. 2. The initiator tRNA (the first or starting tRNA) carrying methionine then binds via complementary base pairing rules. 3. The large subunit of the ribosome then binds placing the initiator tRNA in the P site (you can think of P for polypeptide site). Other proteins known as initiator factors are required along with GTP for initiation to occur, but not shown here…coming soon. AIM: How is genetic information transmitted from DNA to Protein? 1 N STAGE 2: Elongation 1. Codon Recognition: The next tRNA enters the A site. A stands for amino acid as this is the site where amino acids attached to tRNA’s enter the ribosome. 2. Peptide bond formation: The ribosome catalyzes the transfer of the polypeptide (or amino acid if this is the second codon) to the amino acid in the A site resulting in the formation of a peptide. 3. Translocation: The RIBOSOME ONLY moves to the right (translocates) one codon. The P site tRNA enters the E (exit) site and falls out. The A site tRNA enters the P site. The A site is now open and ready for the next amino N N N 3 2 Fig. 10.14 AIM: How is genetic information transmitted from DNA to Protein? QUESTION: The ribosome is translocating along the mRNA. What is the next step? The polypeptide will be transferred to the amino acid in the A-site resulting in the formation of a peptide bond. Fig. 10.12C AIM: How is genetic information transmitted from DNA to Protein? A more realistic view of what elongation looks like: Fig. 10.12A AIM: How is genetic information transmitted from DNA to Protein? STAGE 3: Termination - When the ribosome arrives at a stop codon, a protein called release factor (NOT a tRNA) binds to it and causes the ribosome to break off, releasing the polypeptide. AIM: How is genetic information transmitted from DNA to Protein? STAGE 3: Termination - When the ribosome arrives at a stop codon, a protein called release factor (NOT a tRNA) binds to it and causes the ribosome to break off, releasing the polypeptide. NEW AIM: How is genetic information transmitted from DNA to Protein? Translation (mRNA to protein) AIM: How is genetic information transmitted from DNA to Protein? OVERVIEW This is it! This is how every RNA/polypeptide in all of your cells is made starting from the gene!! The ribosome does not translate the mRNA, what tRNA, the ribosome allows for stable does? tRNA binding and catalyzes the subsequent dehydration reaction leading to peptide bond formation. Fig. 10.15 AIM: How is genetic information transmitted from DNA to Protein? DNA to mRNA to polypeptide (the entire dogma) AIM: How is genetic information transmitted from DNA to Protein? Polyribosomes Many ribosomes can ride along a single piece of mRNA at the same time as shown to the right. Observed in both prokaryotes and eukaryotes Fig. 10.15 Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Question: Write out the polypeptide sequence for the following gene fragment if the top strand is the sense strand (assume no splicing). 3’ 5’ CCGCGATTTAGCGGCTATTA 5’ GGCGCTAAATCGCCGATAAT 3’ CGCTTGTACG The mRNA: 5’ GCGAACATGC GCAUGUUCGCAUUAUCGGCGAUUUAGCGCC 3’ Find the reading frame: The mRNA: 5’ GC-AUG-UUC-GCA-UUA-UCG-GCG-AUUUAG-CGC-C 3’ The polypeptide: (N) Met-Ala-Ala-Leu-Ser-AlaIle (C) AIM: How is genetic information transmitted from DNA to Protein? How are proteins targeted to specific locations like outside the cell or into the ER, Golgi, Lysosome, etc…? (Endomembrane system revisited) This figures shows the how a polypeptide destined to one of the places mentioned above gets access to the ER by having a signal peptide (ER localization signal), with the help of an SRP (a protein + RNA complex) and SRP receptor on the ER. Make sure you know the rest of the story for AIM: How is genetic information transmitted from DNA to Protein? RNA Review Review Chapter 17 - From Gene to Protein AIM: How is genetic information transmitted from DNA to protein? Comparing prokaryotic and eukaryotic gene transcription: Unlike in eukaryotes because of the nucleus, prokaryotes can translate while the RNA polymerase is still transcribing the gene!! Chapter 18 - Genetics of Viruses and Bacteria Questions 1. A point mutation that changes one codon to another, but the amino acid being coded for remains the same. 2. A chemical compound that could potentially cause cancer. 3. Give an example of a spontaneous mutation. 4. Example of a virus that can potentially cause cancer. 5. A mutation that leads to the formation of a stop codon. 6. Describe a specific mutation that would result in a reading frame shift. Chapter 17 - From Gene to Protein NEW AIM: How are genes altered and what is the result? Mutagenes is Muta- = mutation = any change in the sequence of DNA -genesis = origin or production of Therefore, mutagenesis means to “Produce a mutation” or to produce any change in the DNA sequence of an organism. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? What causes mutations? Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Spontane ous vs Induced Mutations Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Spontaneous - Those that occur as a result of natural cell mutations processes like: 1. Copying errors by DNA polymerase during cell cycle or meiosis 2. Errors in DNA repair 3. Errors in recombination (crossing over) Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced 1. Mutations caused by the interactions mutations of DNA with an an outside agent or mutagen Mutagens can be: a. High energy radiation -electromagnetic -gamma rays, X-rays, UV rays -Nuclear radiation -Ex. Alpha particles b. chemical c. virus Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Carcinogen - Prefix carcino- = cancer Ex. Carcinoma – cancer starting from epithelial cell - A carcinogen is a cancer causing agent Recall: How does cancer arise? Cancer results from mutations in specific genes that are involved in controlling the cell cycle (G1 checkpoints). **Therefore, almost all mutagens are also carcinogens since mutagens cause mutations, which can potentially cause cancer. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced mutations A. Mutagens (carcinogens) 1. High energy radiation a. 80 % from natural sources (called background radiation) Electromagnetic radiation (light; photons) Nuclear Radiation (unstable ratio of Protons to neutrons) - UV light from the sun causing thymine dimers, etc… - gamma rays from outside Earth (ex. Distant supern - Soil and certain rocks in the Earth’s crust conta radioactive radon gas This can be problematic in the basements of homes as the radon gas seeps into the basement and is inhaled by the occupants. Living on Long Island, we rarely have this problem as the island was deposited by a glacier. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced mutations A. Mutagens (carcinogens) 1. High energy radiation b. 20% from man-made sources -color TV, smoke detectors, computer monitors, X-ray machines, nuclear plants, etc… Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced mutations A. Mutagens (carcinogens) 1. High energy radiation Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced mutations A. Mutagens (carcinogens) 1. High energy radiation Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced mutations A. Mutagens (carcinogens) 2. Chemicals A. Industrial chemicals Ex. -used to make plastics, but… Acrylamide -occurs in many cooked starchy foods. -discovered in starchy foods, such as potato chips, French fries and bread that had been heated. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced mutations A. Mutagens (carcinogens) 2. Chemicals B. Pollutants Ex. Cigarette Smoke Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? A List of known carcinogens in cigarette smoke Acetaldehyde Acetamide Acrylamide Acrylonitrile 2-Amino-3,4-dimethyl-3H-imidazo[4,5-f]quinoline (MeIQ) 3-Amino-1,4-dimethyl-5H-pyrido [4,3-b]indole (Trp-P-1) 2-Amino-l-methyl-6-phenyl-1H-imidazo [4,5-b]pyridine (PhlP) 2-Amino-6-methyldipyrido[1,2-a:3',2'-d]imidazole (Glu-P-1) 3-Amino-l-methyl-5H-pyrido {4,3-b]indole (Trp-P-2 2-Amino-3-methyl-9H-pyrido[2,3-b]indole (MeAaC) 2-Amino-9H-pyrido[2,3-b]indole (AaC) 4-Aminobiphenyl 2-Aminodipyrido[1,2-a:3',2'-d]imidazole (Glu-P-2) 0-Anisidine Arsenic Benz[a]anthracene Benzene Benzo[a]pyrene Benzo[b]fluoranthene Benzo[j]fluoranthene Benzo[k]fluoranthene Benzo[b]furan Beryllium 1,3-Butadiene Cadmium Catechol (1,2-benzenediol) p-Chloroaniline Chloroform Cobalt p,p'-DDT Dibenz[a,h]acridine Dibenz[a,j]acridine Dibenz(a,h)anthracene 7H-Dibenzo[c,g]carbazole Dibenzo(a,e)pyrene Dibenzo(a,i)pyrene Dibenzo(a,h)pyrene Dibenzo(a,i)pyrene Dibenzo(a,l)pyrene 3,4-Dihydroxycinnamic acid (caffeic acid) Ethylbenzene Ethylene oxide Formaldehyde Furan Glycidol Heptachlor Hydrazine Indeno[1,2,3-cd]pyrene IQ 92-Amino-3-methyl-3H-imidazo[4,5-f]quinoline) Isoprene Lead 5-Methyl-chrysene 2-Naphthylamine Nitrobenzene Nitrogen mustard Nitromethane 2-Nitropropane N-Nitrosodi-n-butylamine (NDBA) N-Nitrosodi-n-propylamine (NDPA) N-Nitrosodiethanolamine (NDELA) N-Nitrosodiethylamine (DEN) N-Nitrosodimethylamine (DMN) N-Nitrosoethylmethylamine (NEMA, MEN) 4-(N-Nitrosomethylamino)-1-(3-pyridinyl)-1-butanone (NNK) N'-Nitrosonornicotine (NNN) N-Nitrosopiperidine (NPIP, NPP) N-Nitrosopyrrolidine (NPYR, NPY) Polonium-210 (Radon 222) Propylene oxide Safrole Styrene Tetrachloroethylene o-Toluidine (2-methylaniline) Trichloroethylene Urethane (carbamic acid, ethyl ester) Vinyl acetate Vinyl chloride 4-Vinylcyclohexene 2,6-Xylidine (2,6-dimethylaniline) Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Benzo[a]pyrene This is what happens to the DNA in your lungs when you suck in benzo[a]pyrene. Then when the cell divides and DNA polymerase tries to copy this DNA, a random base will be inserted causing a mutation. Benzo[a]pyrene DNA adduct Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced mutations A. Mutagens (carcinogens) 2. Chemicals D. Food Additives i. Acesulfame K ii. Artificial coloring (blue-1, blue-2, red-3, yellow6) iii. BHA and BHT iv. Nitrite and Nitrate v. Olestra vi. Potassium Bromate Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Induced mutations A. Mutagens (carcinogens) 5. Certain drugs Ex. Chemotherapy drugs 6. Viruses (Oncoviruses) a. HPV (Human Papilloma Virus) b. EBV (Epstein Barr Virus) c. Hepatitis C virus Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Types of Mutations that can oc Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? 1. Point (substitution) mutations: Wild type A mRNA G U A A G U U U G G C U A A 5 Protein 3 Lys Met Phe Gly Amino end Stop Carboxyl end Base-pair substitution No effect on amino acid sequence U instead of C Silent point mutation A U G A (amino acid remains same) A G U Lys Met Phe Missense Missense point mutation A G U U Gly A A Stop A instead of G U G (amino acid changes to a different amino acid) U U G A A G U Lys Met U U Phe A G U U Ser A A Stop Nonsense U instead of A Nonsense point mutation (amino acid codon changes to a stop codon) A U G U Met Fig. 10.16A A G U U Stop U G G C U A A Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? 1. Point (substitution) mutations: Sickle cell anemia is caused by a point mutation in the hemoglobin gene creating the sickle cell allele. Fig. 10.16A Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Fig. 10.16B Reading Frames -All mRNAs have three possible reading frames as shown above. -The actual reading frame is determined by the promoter and start codon of the mRNA. - A mutation can cause a change in the reading frame…see previous slide. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? 2. Insertions and deletions Wild type A mRNA A G U A G U U G U G C U A A 3 5 Met Protein Lys Gly Phe Amino end Stop Carboxyl end Base-pair insertion or deletion Frameshift causing immediate nonsense Extra U Inserting/deleting nucleotides can shift the reading frame (every codon from the insertion/deletion onward will change) changing every amino acid and possible create a stop codon (very severe mutation)… Deleting or inserting triplets IN FRAME (no frame shift results) will simply remove or add amino acids to the polypeptide (not as severe a mutation as one that causes a frame shift obviously). A G U A U Met A G U G G C U A A Missing U G U U Stop Frameshift causing extensive missense A U A A Met G U Lys U G G C U Ala Leu Insertion or deletion of 3 nucleotides: no frameshift but extra or missing amino acid A A U Met A G Missing G U U Phe U G G Gly C U A Stop A A Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Cause of Tay Sach’s Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Types of Mutations 1. Point mutants or substitutions 2. Deletion 3. Insertion 4. Duplication 5. Inversion 6. Translocation Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Somatic vs Germline mutations Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Somatic mutations Mutations occurring in body cells that can lead to cancer, but are not heritable (can be passed to offspring). Is cancer itself heritable? Cancer is NOT heritable, but the predisposition to get cancer IS! Ex. You can inherit mutations in genes that code for DNA repair proteins causing these proteins not to work. Therefore, when you get mutations in life, you are not able to fix them as well as someone without the mutations and you are more likely to -The famous case are the BRCA1 and BRCA2 alleles which code for DNA repair get cancer sooner… enzymes. (BRCA = breast cancer) Women with either of these mutated alleles are Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Germline mutations Germline cells - gametes and the cells that will become gametes after meiosis. How are these mutations different? Mutations that occur in these cells can be inherited by the offspring. These are the critical ones in terms of evolution. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? ? or Are mutations positive Negative for the organism The majority of mutations tend to be negative (~70% of the time), the remainder are typically neutral (no effect) and in rare cases beneficial. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Positive/Negative/Neutral Somatic cells – negative mutations: - If it is a somatic mutation and causes cancer then obviously it is negative (reduces one’s ability to survive/reproduce). - Random mutations (second law of thermodynamics) in your 1 trillion somatic cells accumulate over time causing proteins to most likely function less efficiently. This can lead to further mutations as well as the characteristics of aging. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Positive/Negative/Neutral Somatic cells – negative mutations: Can a somatic mutation cause a disease like Huntington’s? No, because the mutation happens in only one cell and is not inherited. It would need to be in all cells and that is highly unlikely to ever happen… Can a person with Huntington’s get mutations such that the diseased allele is mutated back to the normal allele and be cured? Is it possible?…I guess it is, but every cell affected by the mutation (tens of millions) would all need to mutate back to the normal allele…I don’t think so… Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Positive/Negative/Neutral Somatic cells – neutral mutations: A good number of mutations are neutral – they have no effect on the organism like the silent mutation or mutations in “junk” DNA or mutations that change amino acids that do not change the function of the protein… Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Positive/Negative/Neutral Somatic cells – positive mutations: It is rare to observe a positive mutation in a somatic cell since it is only one cell out of 1 trillion. You will likely never see it. However, cancerous cells, which are your somatic cells gone rogue, can have positive mutations allowing them to move more easily and divide more readily. Although this is not positive for the organism, it is temporarily positive for the cancer cells in terms of reproduction… Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Positive/Negative/Neutral Germline cells – negative mutations: 1. The mutation is Negative if the offspring has a reduced ability to survive and reproduce in the current environment. A. Why do I say “current environment”? i. Because a mutation can be negative in one environment, but positive in another like the sickle cell allele (negative in US, but positive in Africa). Ex. Mutation that generated the Huntington’s disease allele, mutations in DNA repair genes that predispose the individual to cancer (BRCA-1 allele), or perhaps a mutation that reduced the efficiency of ATP production… Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Positive/Negative/Neutral Germline cells: Neutral mutations, similar to somatic neutral mutations, have no positive or negative effect on the organism that is obvious. Ex. Silent Mutations, mutations in “junk” DNA, mutation that changes your fingerprint, etc… Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Positive/Negative/Neutral Germline cells – positive mutations: Positive if the offspring has a ENHANCED ability to survive/reproduce in the current environment. Ex. Mutation in hemoglobin resulting in the sickle cell allele in Africa, mutation that resulting in the generation of the blue eye allele in northern Europe (advantage may be better vision in the lower light conditions), mutation that generated the allele in certain humans that confers resistance to HIV… Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? What do all these germline mutations have in common whether positive or negative? Mutations Randomly Create New Alleles Without mutation, there would be no new alleles, organisms would never change (no evolution!). Why would this not be good? Because the environment changes over time, and if organisms cannot change to keep up with it there will be no organisms. Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Mutations are the Creative Force behind The creative force behind evolution is evolution!! Creative Force behind evolution = mutation!! mutation. Mutation = Creative Force behind evolution Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Mutations are the Creative Force behind evolution!! Nature is a selective force, an allele “filter” only letting some of these randomly generated alleles survive and make it to the next generation! Chapter 17 - From Gene to Protein AIM: How are genes altered and what is the result? Mutations can be a tool for scientists… Ex. You have determined the structure of an enzyme and you now want to know which amino acids are important for catalyzing the reaction. How could you determine this? 1. Mutate the gene to change the amino acid to glycine, which doesn’t have sideenzyme. chain. 2. Testa the 3. If it still works then the side chain is not important. If it doesn’t work, the side chain