Chapter 10
 Explain the research of the following scientists:
 Griffith: worked with pneumonia bacteria and mice to
track how infection occurs. Results: Harmless bacteria
that were exposed to heat-killed harmful bacteria were
transformed to harmful bacteria.
 Avery: Used enzymes to break down pneumonia bacteria.
Results: DNA is the transforming factor that causes
infection.
 Hershey and Chase: Worked with bacteriophages (viruses
that infect bacteria only). Results: DNA from virus is
what causes viral infections.
 Franklin and Wilkins: Used X-Ray diffraction to take photos
of DNA.
 Watson and Crick: Credited with discovering DNA double
helix structure since they could analyze X-ray diffraction
photos.
 Chargaff: Discovered rules of base pairing. A=T, G=C
 What is the role of DNA?
 The role of DNA is to store and transfer genetic
information like a library.
 What is a nucleotide and what are the three parts to
it?
 A nucleotide is a monomer of a nucleic acid (DNA and
RNA). The three parts of a nucleotide are the 5-carbon
sugar, phosphate group, and nitrogenous base.
 What two nitrogenous bases are purines?
Pyrimidines?
 Purines = Adenine and Guanine
 Pyrimidines = Thymine and Cytosine
 What type of bonds hold DNA together and where
are they located?
 Hydrogen bonds: between the nitrogenous bases
 Covalent bonds: between the sugar and phosphate
backbone
 List the steps to DNA replication.
 1. Helicase breaks the hydrogen bonds between base
pairs and “unzips” DNA.
 2. DNA polymerase adds new DNA nucleotides to DNA
template strands.
 3. DNA polymerase releases once it reaches the end of
the DNA strands. Create two semi-conservative DNA
strands.
 What do the following enzymes do during DNA
replication?
 Helicase: Breaks hydrogen bonds between nitrogenous
base pairs, “unzips” DNA strands.
 DNA polymerase: Adds new DNA nucleotides to template
strands of DNA.
 Ligase: Bonds lagging strand Okazaki fragments
together.
 What does semi-conservative mean?
 Term used to explain that the new strands of DNA made
contain half of the original strand. Half of the parent
strand is conserved.
 What are the three differences between DNA and
RNA?
 DNA has a deoxyribose sugar. RNA has a ribose sugar.
 DNA is double stranded. RNA is single stranded.
 DNA uses thymine. RNA used uracil.
 What are the three types of RNA used during protein
synthesis and explain their function?
 mRNA – messenger RNA, recipe to make proteins
 rRNA – ribosomal RNA, found in ribosomes
 tRNA – transfer RNA, transfers amino acids to ribosomes
 What is a codon and where is it found?
 A codon is a 3 letter sequence found in mRNA.
 What is an anti-codon and where is it found?
 An anti-codon is a 3 letter sequence found in tRNA.
 Write the mRNA strand for this DNA strand:
TACGGCATGAACGTAGCTAGCACT
 AUG-CCG-UAC-UUG-CAU-CGA-UCG-UGA
 What are the amino acids that correspond to the mRNA
strand you just made?
 Met-Pro-Tyr-Leu-His-Arg-Ser-STOP
 List the steps to transcription.
 Takes place in the nucleus
 RNA polymerase binds to promoter, “unzips” DNA
 RNA polymerase adds RNA nucleotides to the DNA
template
 RNA polymerase reaches the STOP codon and releases
 mRNA needs to add a poly A tail and cap before going to
cytoplasm
 List the steps to translation.
 Takes place on a ribosome in the cytoplasm
 Ribosome subunits bind together, tRNA binds to START
(AUG) codon
 tRNA brings amino acids to the ribosomes
 tRNA reaches STOP codon and releases from ribosome
 Ribosome breaks down back into subunits
 What are the roles of the following proteins
do during protein synthesis?
 RNA polymerase: binds to promoter on DNA,
“unzips” DNA, adds RNA nucleotides
 Ribosomes: Protein factory found in the
cytoplasm
 What is the purpose of the human genome
project?
 Map out chromosomes to help find
cures/prevention for diseases.