C H A P T E R 5 MOLECULAR BASIS OF INHERITANCE Learning Objectives Students will be able to learn about 1. Structure of DNA and its significance. 2. Formation of proteins via DNA through mRNA. 3. Gene Expression and control. 4. Genome projects and its advantages. List of Topics Topic-1: Nucleic Acid – DNA and RNA ������������������������������������������� Topic-2 : Genetic Code, Translation, Lac Operon, HGP and DNA Fingerprinting��������������� TOPIC-1 Nucleic Acid – DNA and RNA Concepts Covered Nucleic acids, packaging of DNA helix, Nucleosome, Experiments to show DNA as a genetic material, RNA, process of protein synthesis. Revision Notes Genetic Material ¾¾ Nucleic Acids DNA and RNA are the two types of nucleic acids. DNA is the genetic material in all organisms except some viruses. RNA is the genetic material in some viruses. RNA mostly functions as messenger. ¾¾ Structure of Polynucleotide Chain Polynucleotides are the polymers of nucleotides. DNA and RNA are examples of polynucleotides. A nucleotide has 3 components : (i) A nitrogenous base (ii) A pentose sugar (ribose in RNA and deoxyribose in DNA) (iii) A phosphate group Nitrogen bases are of 2 types : (a) Purines : It includes Adenine (A) and Guanine (G). (b) Pyrimidines : It includes Cytosine (C), Thymine (T) and Uracil (U). Thymine (5-methyl Uracil) present only in DNA and Uracil only in RNA ( In place of thymine). A nitrogenous base is linked to the pentose sugar through an N-glycosidic linkage to form nucleoside. Nucleosides in RNA Nucleosides in DNA Adenosine Deoxyadenosine Guanosine Deoxyguanosine Cytidine Deoxycytidine Uridine Deoxythymidine Nitrogen base + sugar + phosphate group = Nucleotide (deoxyribonucleotide). In RNA, every nucleoside residue has an additional –OH group present at 2’-position in the ribose (nucleoside=Ribose sugar+ Base pair) phosphate group is absent in nucleoside. 2 nucleotides are linked through 3’ → 5’ phosphodiester bond to form dinucleotide. When series of nucleotides are linked together, it forms polynucleotide. ¾¾ Structure of DNA Johann Friedrich Miescher (1869): Identified DNA and named it as ‘Nuclein’. James Watson & Francis Crick proposed the double helix model of DNA. It was based on the X-ray diffraction data produced by Maurice Wilkins & Rosalind Franklin. DNA is made of two polynucleotide chains coiled in a right-handed fashion. Its backbone is formed of sugar and phosphates. The bases project inside. The two chains have anti-parallel polarity i.e., one chain has the polarity 5’ → 3’ and the other has 3’ → 5’. Nitrogen bases of opposite chains are held together by hydrogen bonds forming base pairs (bp). There are two hydrogen bonds between A and T (A = T) and three H-bonds between C and G (C ≡ G). Purine comes opposite to a pyrimidine. This generates a uniform distance between the two strands. ¾¾ Erwin Chargaff’s Rule Purines and pyrimidines are always in equal amounts i.e., A + G = T + C. In DNA, the proportion of A is equal to T and the proportion of G is equal to C i.e., A = T and G = C. Molecular Basis of Inheritance Q. Calculate the number of beaded structures (nucleosomes) present in the nucleus of diploid eukaryotic cell which possess 2.2 × 106 bp. Sol. One nucleosome has 200 bp. The number of beaded structures (nucleosomes) present in the nucleus of diploid eukaryotic cell which possess 2.2 × 106 bp. \ 2.2 ´10 6 = 1.1 × 104 or 11 × 103 nucleosomes 200 ¾ ­ ¾ ¾ ¾ ¾ The Search for Genetic Material Griffith’s Experiment - Transforming Principle Griffith (1928) used mice and a bacterial strain, Streptococcus pneumoniae. Streptococcus pneumoniae has two strains : (a) Smooth (S) strain (Virulent): Has polysaccharide mucous coat. Causes pneumonia. (b) Rough (R) strain (Non-virulent): No mucous coat. Does not cause pneumonia. ¾ Experiment S-strain → Inject into mice → Mice die R-strain → Inject into mice → Mice live S-strain (Hk) → Inject into mice → Mice live S-strain (Hk) + R-strain (live) → Inject into mice → Mice die He concluded that there exists some ‘transforming principle’, that is transferred from heat-killed S-strain to R-strain. It enabled R-strain to synthesise smooth polysaccharide coat and become virulent. This must be due to the transfer of genetic material. ¾ Biochemical Characterisation of Transforming Principle Oswald Avery, Colin MacLeod & Maclyn McCarty in 1944 worked to determine the biochemical nature of ‘transforming principle’ in Griffith’s experiment. They purified biochemicals (proteins, DNA, RNA, etc.) from heat-killed S cells using suitable enzymes. They discovered that: (a) Digestion of protein and RNA (using Proteases and RNases) did not affect transformation. So, the transforming substance was not a protein or RNA. (b) Digestion of DNA with DNase inhibited transformation. It means that DNA caused the transformation of R cells to S cells i.e., DNA was the transforming substance. ¾ The Genetic Material is DNA The fact that DNA is the genetic material also came from the experiments of Alfred Hershey and Martha Chase (1952). They worked with viruses that infect bacteria and are called bacteriophages. ¾ Hershey-Chase Experiment—Blender Experiment Hershey and Chase made two preparations of bacteriophage – In one, proteins were labelled with 35 S by putting in a medium containing radioactive sulphur (35S). In the second, DNA was labelled with 32 P by putting in a medium containing radioactive Phosphorous (32P). ¾ ¾ ¾ ¾ Packaging of DNA Helix In prokaryotes (e.g., E. coli), the DNA molecule is held with some positively charged non-histone basic proteins like negatively charged polyamines and form ‘nucleoid’. In eukaryotes, it involves a number of molecules. Histones, Histone octamer, Nucleosome, Chromatin. Two types of chromatin are: (a) Euchromatin: Loosely packed and transcriptionally active chromatin and is light-stained. (b) Heterochromatin: Densely packed and inactive region of chromatin and stains dark. In eukaryotes, there is a set of positively charged basic proteins called histones. Histone proteins are rich in positively charged basic amino acid residues lysine and arginine. There are five types of histone proteins-H1, H2A, H2B, H3 and H4. Two molecules each of H2A, H2B, H3 and H4 organize to form a unit of eight molecules called as histone octamer. Negatively charged DNA is wrapped around positively charged histone octamer to form a structure called a nucleosome. Nucleosomes are connected with the help of linker DNA on which H1 Histone is present. ¾ Nucleosome A typical nucleosome contains 200 bp of DNA helix. Therefore, the total number of nucleosomes in human = 6.6 × 109 bp/200 bp = 3.3 × 107. Nucleosomes constitute the repeated unit to form chromatin. Chromatin is the thread-like stained bodies. Nucleosomes in chromatin appears as “beadson-string” when it is viewed under the electron microscope. Chromatin is packaged to form a solenoid or a zig-zag structure. Further supercoiling constitute a looped structure called chromatin fibre. These chromatin fibres further coil and condense at the metaphase stage of cell division to form chromosomes. Chromatin is packaged → solenoid → chromatin fibres → coiled and condensed at metaphase stage → chromosomes. Higher level packaging of chromatin requires nonhistone chromosomal (NHC) proteins. Example-1 The base ratio A + T/G + C may vary from species to species but constant for a given species. Length of DNA = number of base pairs × distance between two adjacent base pairs. f 174 (a bacteriophage) has 5386 nucleotides. Bacteriophage lambda has 48502 base pairs (bp). E. coli has 4.6 × 106 bp. Haploid content of human DNA = 3.3 × 109 bp. Number of base pairs in human = 6.6 × 109 Length of DNA in humans = 6.6 × 109 bp × 0.34 × 10–9 m/bp = 2.2 m Length of DNA in E. coli =1.36 mm (1.36 × 10–3 m). \ The number of base pairs = 1.36 × 10–3 m/0.34 × 10–9 m/bp = 4 × 106 bp. BIOLOGY, Class-XII Presence of thymine Presence of uracil Absence of 2’-OH Presence of 2’-OH ¾ The two DNA strands are complementary. On heating, they separate. When appropriate conditions are provided they come together. (In Griffith’s experiment, when the bacteria were heat-killed, some properties of DNA did not destroy). ¾ RNA World RNA is a single-stranded structure but it is often folded back upon itself forming helices. Nitrogenous bases are like those of DNA except that there is uracil in place of thymine. RNA was the first regulatory chemical and genetic material in early life forms. ¾ ¾ ¾ ¾ ¾ Single-stranded Double-stranded ­ Reasons for mutability (high reactivity) of RNA ­ Reasons for stability (less reactivity) of DNA It acts as genetic material and biocatalyst. Essential life processes (metabolism, translation, splicing, etc) evolved around RNA. DNA has evolved from RNA with chemical modifications that made it more stable. ¾ Central Dogma of Molecular Biology It was proposed by Francis Crick (1958). It states that the genetic information flows unidirectionally from DNA → RNA → Protein. ¾ Reverse Transcription: H. Temin and Baltimore in 1978 gave the concept of reverse flow of genetic information i.e., the formation of DNA from RNA. This is called Reverse Central Dogma or Teminism or reverse transcription. This takes place in some of the viruses in the presence of an enzyme called reverse transcriptase. ¾ Types of RNA RNA is of 3 types –mRNA, tRNA and rRNA. mRNA constitutes 2–5% of the total cellular RNA, tRNA is about 15% and rRNA is about 70–80%. mRNA (messenger RNA): Provides a template for translation (protein synthesis) and is transcribed from DNA. rRNA (ribosomal RNA): Structural and catalytic role during translation. e.g., 23S rRNA in bacteria acts as ribozyme. It is the component of ribosome and is the most stable type of RNA. tRNA (transfer RNA or sRNA or soluble RNA or adaptor RNA): Brings amino acids for protein synthesis and reads the genetic code. tRNA is the smallest amongst all the RNA and is made up of 70–80 nucleotides only. ¾ DNA Replication [Board 2019] Replication is the copying of DNA from parental DNA. Watson & Crick proposed a semi-conservative mode of replication. It suggests that the parental DNA strands act as a template for the synthesis of new complementary strands. After the completion of replication, each DNA molecule would have one parental and one new strand. ¾ Experimental Proof Mathew Meselson & Franklin Stahl (1958) experimentally proved semi-conservative mode. Meselson & Stahl’s Experiment: They cultured E. coli in a medium containing N15H4Cl (N15: heavy isotope of N). N15 was incorporated into both strands of bacterial DNA and the DNA became heavier. Another preparation containing N salts labelled with N14 was also made. N14 was also incorporated in both strands of DNA and became lighter. These two types of DNA can be separated by centrifugation in a CsCl density gradient. They took E. coli cells from the N15 medium and transferred them to the N14 medium. After one generation (i.e., after 20 minutes), they isolated and centrifuged the DNA. Its density was intermediate (hybrid) between 15N DNA and 14N DNA. ¾ ¾ These preparations were used separately to infect E. coli. After infection, the E. coli cells were gently agitated in a blender to separate the phage particles from the bacteria. Then the culture was centrifuged. Heavier bacterial cells were formed as a pellet at the bottom. Lighter viral components outside the bacterial cells remained in the supernatant. They found that, (a) Supernatant contains viral protein labelled with 35 S, i.e., the viral protein had not entered the bacterial cells. (b) The bacterial pellet contains radioactive 32P. This shows that viral DNA labelled with 32P had entered the bacterial cells. This proves that DNA is the genetic material. ¾ Properties of Genetic Material A molecule that can act as a genetic material must fulfil the following criteria: (a) Be able to generate its replica by the process of replication. (b) Chemically and structurally be stable. (c) Allow slow changes, the mutations that are required for evolution. (d) It should be able to store genetic information which can be inherited. (e) Be able to express itself as ‘Mendelian Characters’. ¾ DNA is a better Genetic Material than RNA due to the following reasons : DNA is chemically less reactive and structurally more stable. It can to undergo repair. Due to the unstable nature of RNA, RNA viruses (e.g., Qb Bacteriophage, Tobacco Mosaic Virus, etc.) mutate and evolve faster. For the storage of genetic information, DNA is better due to its stability. But for the transmission of genetic information, RNA is better. RNA can directly code for protein synthesis, hence can easily express the characters. DNA is dependent on RNA for protein synthesis. Molecular Basis of Inheritance ¾ ¾ ¾ It consists of 3 regions : (a) A promoter (Transcription start site) : Binding site for RNA polymerase. (b) Structural gene : The region between promoter and terminator where transcription takes place. (c) A terminator : The site where transcription stops. The DNA- dependent RNA polymerase catalyses the polymerization only in 5’→3’direction. 3’→5’ acts as the template strand. 5’→3’ acts as the coding strand. 3’–ATGCATGCATGCATGCATGCATGC–5’ template strand. 5’–TACGTACGTACGTACGTACGTACG–3’ coding strand. ¾ Transcription Unit and the Gene Gene: Gene is Functional unit of inheritance. It is the DNA sequence coding for RNA molecule. Cistron: A segment of DNA coding for a polypeptide. Structural gene in a transcription unit is of two types : (a) Monocistronic structural genes (split genes): It is seen in eukaryotes. Here, the coding sequences (expressed sequences or exons) are interrupted by introns (intervening sequences). (b) Polycistronic structural genes: It is seen in prokaryotes. Here, there are no split genes. Exons and Introns: In eukaryotes, the monocistronic structural genes have interrupted coding sequences i.e., the genes in eukaryotes are split. The coding sequences or expressed sequences are called as exons. Exons are said to be those sequences that appear in mature or processed RNA. The exons are interrupted by introns. Introns or intervening sequences do not appear in mature or processed RNA. ¾ Steps of transcription in prokaryotes Initiation: Here, the enzyme RNA polymerase binds at the promoter site of DNA. This causes the local unwinding of the DNA double helix. An initiation factor (s factor) present in RNA polymerase initiates the RNA synthesis. Elongation: The RNA chain is synthesised in the 5’3’ direction. In this process, activated ribonucleoside triphosphates (ATP, GTP, UTP & CTP) are added. This is complementary to the base sequence in the DNA template. Termination: A termination factor (r factor) binds to the RNA polymerase and terminates the transcription. In bacteria (Prokaryotes), transcription and translation can be coupled (Translation can begin before mRNA is fully transcribed) because mRNA requires no processing to become active. Transcription and translation take place in the same compartment (no separation of cytosol and nucleus). ¾ In eukaryotes, there are 2 additional complexities: (a) There are three RNA polymerases : RNA polymerase I: Transcribes rRNAs (28S, 18S & 5.8S). ¾ ¾ ¾ This showed that in the newly formed DNA, one strand is old (N15 type) and one strand is new (N14 type). This confirms the semi-conservative mode of replication. After II generations (i.e., after 40 minutes), there were equal amounts of hybrid DNA and light DNA. Taylor et. al (1958) performed similar experiments on Vicia faba (faba beans) using radioactive thymidine to detect distribution of newly synthesised DNA in the chromosomes. It proved that the DNA in chromosomes also replicate semi-conservatively. ¾ The Machinery and Enzymes for Replication DNA replication starts at a point called origin (ori). A unit of replication with one origin is called a replicon. During replication, the two strands unwind and separate by breaking H-bonds in the presence of an enzyme, Helicase. Unwinding of the DNA molecule at a point forms a ‘Y’shaped structure called replication fork. The separated strands act as templates for the synthesis of new strands. DNA replicates in the 5’→3’ direction. Deoxyribonucleoside triphosphates (dATP, dGTP, dCTP & dTTP) act as substrate and also provide energy for polymerisation. Firstly, a small RNA primer is synthesised in presence of an enzyme, primase. In the presence of an enzyme, DNA dependent DNA polymerase, many nucleotides join with one another to primer strand and form a polynucleotide chain (new strand). The DNA polymerase forms one new strand (leading strand) on a continuous stretch in the 3’→5’ direction (Continuous synthesis). The other new strand is formed in small stretches (Okazaki fragments) in the 5’→3’ direction (Discontinuous synthesis). The Okazaki fragments are then joined together to form a new strand by an enzyme, DNA ligase. This new strand is called lagging strand. If a wrong base is introduced in the new strand, DNA polymerase can do proofreading. E. coli completes replication within 38 minutes i.e., 2000 bp per second. In eukaryotes, the replication of DNA takes place at the S-phase of the cell cycle. Failure in cell division after DNA replication results in polyploidy. ¾ Transcription [Board 2020] It is the process of copying genetic information from one strand of the DNA into RNA. Here, adenine pairs with uracil instead of thymine. Both strands are not copied during transcription, because (a) The code for protein is different in both strands. This complicates the translation. (b) If two RNA molecules are produced simultaneously they would be complementary to each other, hence form a double-stranded RNA. This prevents translation. ¾ Transcription Unit It is the segment of DNA between the sites of initiation and termination of transcription. BIOLOGY, Class-XII - Capping: Here, a nucleotide methyl guanosine triphosphate (cap) is added to the 5’ end of hnRNA. Tailing (Polyadenylation): Here, adenylate residues (200–300) are added at 3’ end. It is the fully processed hnRNA, now called mRNA. - RNA polymerase II: Transcribes the hete­ rogeneous nuclear RNA (hnRNA). It is the precursor of mRNA. RNA polymerase III: Transcribes tRNA, 5S rRNA and snRNAs (small nuclear RNAs). (b) The primary transcripts (hnRNA): They contain both the exons and introns and are non functional. Hence introns have to be removed. For this, it undergoes the following processes : Splicing: From hnRNA, introns are removed (by the spliceosome) and exons are spliced (joined) together. [Board, 2015] MNEMONICS 1. Concept: Erwin Chargaff’s Rule Mnemonics: AayaTha; ChalaGya Interpretations: A- Adenine = T- Thymine G-Guanine = C- Cytosine 2. Concept: Central Dogma of Molecular Biology Mnemonics: Doctors Recovered Patients Interpretations: DNA RNA → Protein Important Diagrams : Fig 5.1 : A polynucleotide Chain of DNA Fig 5.2 : Double Stranded polynucleotide chain DNA H1 histone Histone octamer Core of histone molecules Fig 5.3 : Central Dogma Fig 5.4 : Nucleosome Molecular Basis of Inheritance Bacteriophage Radioactive (35S) labelled protein capsule Radioactive (32P) labelled DNA GC AT AT GC TA 1. Infection CG AT GC TA 2. Blending 3. Centrifugation No Radioactive (35S) detected in cells + Radioactive [35S] detected in supernatant 5’ No Radioactive (32P) detected in cells + No radioactivity detected in supernatant 14 CG A T C A C G GC TA AT CG AT CG AT GC AT GC A T GC TA TA GC Generation II N-DNA N-DNA 14 N-DNA 40 min 15 20 min N-DNA 14 Gravitational force N-DNA 14 15 15 N N Heavy 14 15 N N Hybrid N14N 14N15N Light Hybrid 14 Separation of DNA by centrifugation Fig. 5.7 : Meselson and Stahl’s Experiment Fig 5.8 : Replicating Fork 3’ Fig 5.6 : Watson Crick model of Semi-conservative DNA replication Generation I N-DNA G TA GC Fig 5.5 : The Hershey and Chase Experiment 15 T A T Fig 5.9 : Schematic structure of a transcription unit BIOLOGY, Class-XII 5' 3' Initiation 5' s Promoter Sigma factor RNA polymerase DNA helix 5' 3' Elongation 3' 5' RNA Terminator 3' Termination 3' 5' 5' r RNA 3' Rho factor RNA polymerase Fig 5.10 : Process of Transcription in Bacteria 5' 3' Cappingcap m 5' Gppp 3' mRNA Intron Exon RNA splicing Polyadenylation 3' Poly a tail m Gppp 3' m Gppp m Gppp Messenger RNA (mRNA) Fig 5.11 : Process of Transcription in Eukaryotes SUBJECTIVE TYPE QUESTIONS Very Short Answer Type Questions (1 mark each) 1. What happen’s when in a bacterium RNApolymerase binds to the promoter on a transcription unit during transcription? K [Delhi Set-1, 2020] Concept Applied Transcription Ans. When RNA-polymerase binds to the promoter on a transcription unit during transcription it initiates the process. 2. Name one amino acid, which is coded by only one codon. Ap [Comptt, Set-1, 2018] 3. A region of a coding DNA strand has the following nucleotide sequence : – ATGC – What shall be the nucleotide sequence in (i) sister DNA segment it replicates, and (ii) m-RNA polynucleotide it transcribes ? K [Foreign Set-1, 2, 3, 2017] This Question is for practice and its solution is given at the end of the chapter. Concept Applied Replication Ans. (i) - TACG - (ii) - AUGC- ½+½ [Marking Scheme, 2017] 4. Mention one difference to distinguish an exon from an intron. U [Foreign Set-1, 2016] Concept Applied Transcription Ans. Exon : Coded/expressed sequence of nucleotides in mRNA. Intron : Intervening sequence of nucleotides not appearing in processed mRNA. 1 [Marking Scheme, 2016] Molecular Basis of Inheritance 5. Retroviruses have no DNA. However the DNA of the infected host cell does possess viral DNA. How is it possible? Ap [Outside Delhi Set-I, 2015] Ans. RNA is the genetic material in retrovirus. This RNA forms DNA by the process of reverse transcription with the help of the enzyme called reversetranscriptase. 1 functional only after processing by splicing. During splicing, the introns are removed and exons are joined. hnRNA also undergoes two additional processes called capping and tailing. During capping, the unusual nucleotide methyl guanosine triphosphate (mGPPP) is added to the 5' end of hnRNA. In tailing, about 200–300 adenylate residues are added at the 3' end of mRNA. Now, this is the fully processed hnRNA which is called mRNA. It is now functional and is ready for translation. The splicing of hnRNA occurs in the nucleus. 2 Short Answer Type Questions-I (2 marks each) Short Answer Type Questions-II (3 marks each) 1. What are 'SNPs'? Where are they located in a human cell? State any two ways the discovery of SNPs can be of importance to humans. R + Ap [Delhi Set-1, 2020] Ans. SNPs are a Single nucleotide polymorphism. It is the variation in the genome of the organisms within a particular species because of changes in the sequence of a single nucleotide. SNPs are located within the chromosome in certain discrete locations. Importance of SNPs : (i) Used to identify genetic regions associated with certain genetic disorders. (ii) Used in forensic sciences. 1+1+1 2. (a) Identify the polarity of x to x’ in the diagram below and mention how many more amino acids are expected to be added to this polypeptide chain. 1. Carefully examine structures A and B of pentose sugar given below. Which one of the two is more reactive? Give reasons. A [SQP, 2020-21] Ans. A is more reactive ½ 2'–OH group present in the pentose sugar ½ makes it more labile, catalytic and easily degradable. ½ + ½ = 1 [CBSE Marking Scheme, 2020] 2. Although a prokaryotic cell has no defined nucleus, yet DNA is not scattered throughout the cell. Explain. U [CBSE, Outside Delhi/Delhi, 2018] Bor Ans. DNA is a negatively charged, positively charged protein, holds it in place, in large loops (in a region termed as nucleoid). ½×4 [CBSE Marking Scheme, 2018] AG G 3. Describe the structure of a nucleosome. U [Foreign, Set-II, 2017] Brr Concept Applied Packaging of DNA Concept Applied Transcription Ans. hnRNA is the primary transcript. It is non functional. It contains both the coding region-exons and noncoding regions called introns in RNA. It is called heterogeneous nuclear RNA or hnRNA. It gets CUCUUGGGUCCGCAGUUUAA x Ans. (i) A typical nucleosome contains 200 bp of DNA helix. (ii) Negatively charged DNA is wrapped around positively charged histone octamer. (iii) It constitutes the repeating unit to form chromatin. (iv) The chromatin appears as ’’beads on string’’. (v) The chromatin is packed to form a solenoid structure and further supercoiling constitute a looped structure called chromatin fibre. (vi) Higher level packaging of chromatin requires non-histone chromosomal (NHC) proteins. 4. Why does hnRNA need to undergo splicing? Where does splicing occur in the cell? U [CBSE, Delhi Set-1 & 3 Comptt. 2016] x' (b) Mention the codon and anticodon for alanine. (c) Why are some untranslated sequences of bases seen in mRNA coding for a polypeptide? Where exactly are they present on mRNA? K [CBSE Solve 2021] [3] Concept Applied Translation Ans. (a) x to x’ is 5' → 3' [½] No more amino acids will be added [½] (b) Codon is GCA [½] Anticodon is CGU [½] (c) The untranslated regions are required for an efficient translation process. [½] They are present before the initiation codon at the 5’ – end and after the stop/termination codon, at the 3’ – end. [½] BIOLOGY, Class-XII 5. (a) State the hypothesis that S.L. Miller tried to prove in the laboratory with the help of the set up given above. (b) Name the organic compound observed by him in the liquid water at the end of his experiment. (c) A scientist simulated a similar set up and added CH4, NH3 and water vapour at 800°C. Mention the important component that is missing in his experiment? K [SQP 2023–24] 3. Explain the mechanism of DNA replication with the help of a replication fork. What role does the enzyme DNA-ligase play in a DNA replication fork? U [Delhi Set-1, 2019] Concept Applied DNA Replication (a) The process of DNA replication begins at a point called the origin of replication (ori), to form a replication fork. Ans:(a) Chemical evolution: First form of life originated from pre-existing non-living organic molecules. (b) Amino acids (c) H2 [Marking Scheme SQP 2023–24] Long Answer Type Questions Ans. RNA polymerase II. 1 Capping- unusual nucleotide (methyl guanosine triphosphate) is added to the 5’ end of the hnRNA, 1 Tailing-adenylate residues are added at 3’ end in a template-independent manner 1 [Marking Scheme, 2019] Concept Applied DNA is a Genetic material Ans.(a) Alfred Hershey and Martha Chase carried out their experiments to prove that DNA is the genetic material and not the protein. (b) (i) They used radioactive phosphorus (32P) and radioactive sulphur (35S). They grew some viruses on a medium that contained radioactive phosphorus and some others on medium that contained radioactive sulphur. Viruses grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protein does not. Similarly, viruses grown on radioactive sulphur contained radioactive protein but not radioactive DNA because DNA does not contain sulphur. (ii) Blender : To separate the viral protein coats that are still attached to the surface of bacteria. Centrifuge : To separate lighter supernatant (containing viral protein coats) from the denser residue (containing bacteria). (iii) Observations : (a) Bacteria that were infected with viruses having radioactive DNA were found to contain radioactive DNA. (b) Bacteria that were infected with viruses having radioactive protein coat were not found to contain radioactivity. Conclusion : DNA is the genetic material that is passed from virus to bacteria and not the protein. 1+2+2 (b) The separated strands act as templates for the synthesis of new strands. (c) DNA replicates in the 5’ → 3’ direction. (d) dNTPs (Deoxyribonucleotide triphosphate) act as substrate and also provide energy for the polymerization of nucleotides. (e) DNA polymerase is an enzyme that assembles a new DNA strand that is complementary to the template strand. (f) DNA polymerase continues to move along the template strand and add new nucleotides to the growing or complementary strand until the entire genome is replicated. (g) The DNA polymerase forms one new strand (leading strand) in a continuous stretch in the 5’ → 3’ direction (continuous synthesis). (h) The other new strand is formed in small stretches (Okazaki fragments) in the 5’ → 3’ direction (discontinuous synthesis). (i) The Okazaki fragments are then joined together to form a new strand by an enzyme, DNA ligase. This new strand is called the lagging strand. The function of DNA ligase is to join two nucleotides. During the DNA replication process, it joins Okazaki fragments together to form the complete DNA strand . 3 4. Name the enzyme that transcribes hnRNA in eukaryotes. Explain the steps that the hnRNA undergoes before it is processed into mRNA. U [Outside Delhi Set-2, 2019] (5 marks each) 1. (a) State the reasons for which Hershey and Chase carried out their experiments. (b) Answer the following questions based on the experiments of Hershey and Chase : (i) Name the different radioactive isotopes they used, and explain how they used them. (ii) Why did they need to agitate and spin their culture? (iii) Write their observations and the conclusions they arrived at. U [Outside Delhi Set-3, 2019] Molecular Basis of Inheritance (a) State the ‘Central dogma’ as proposed by Francis Crick. Are there any exceptions to it? Support your answer with a reason and an example. (b) Explain how the biochemical characterisation (nature) of “Transforming Principle” was determined, which was not defined from Griffith’s experiments. Ap [Delhi 2018] 2. Topper's Answer, 2018 BIOLOGY, Class-XII 4. 5. In the mid-twentieth century, scientists were still unsure as to whether DNA or protein was the genetic material of the cell. It was known that some viruses consisted solely of DNA and a protein coat and could transfer their genetic material into hosts. In 1952, Alfred Hershey and Martha Chase conducted a series of experiments. (a) State the reasons for which Hershey and Chase carried out their experiments. (b) Answer the following questions based on the experiments of Hershey and Chase: (i) Name the different radioactive isotopes they used, and explain how they used them. (ii) Why did they need to agitate and spin their culture? (iii) Write their observations they arrived at. [SQP 2023 – 24] OR (i) Describe the series of experiments of F. Griffith. Comment on the significance of the results obtained. (ii) State the contribution of Macleod, McCarty and Avery. U + A [Outside Delhi Set-2, 2016] OR (i) Explain with the help of Griffith’s experiment how the search for genetic material was conducted and what was the conclusion drawn? (ii) How did Macleod, McCarty and Avery establish the biochemical nature of the so called “genetic material” identified by Griffith in his experiment. U + Ap [Delhi Set-2, Comptt. 2016] Concept Applied Transcription + Translation Ans: 5’--ATG ACC GTA TTT TCT GTA GTG CCC GTA CTT CAG GCA TAA—3’= Coding strand (a) 3’- TAC TGG CAT AAA AGA CAT CAC GGG CAT GAA GTC CGT ATT---5’= Template strand1 5’---AUG ACC GUA UUU UCU GUA GUG CCC GUA CUU CAG GCA UAA---3’ == mRNA strand1 (b) i. In a bacterium 5’---AUG ACC GUA UUU UCU GUA GUG CCC GUA CUU CAG GCA UAA---3’ 1 ii. In humans 5’---mGpppAUG ACC UUU UCU GUG CCC CUU CAG GCA UAA- Poly A tail--3’ 1 (c) Nine amino acids in the polypeptide because UAA is stop/terminator codon and does not code for any amino acid. [Marking Scheme SQP 2023–24] (ii) Sigma factor associates with RNA polymerase to initiate transcription, Rho factor gets associated with RNA polymerase to terminate transcription. ½+½ (iii) RNA polymerase I - Transcribes -RNAs ½ RNA polymerase III - Transcribes tRNA / 5srRNA / 5SnRNA ½ [Marking Scheme, 2016] 3. Given below is a stretch of DNA showing the coding strand of a structural gene of a transcription unit? 5’--ATG ACC GTA TTT TCT GTA GTG CCC GTA CTT CAG GCA TAA—3’ (a) Write the corresponding template strand and the mRNA strand that will be transcribed, along with its polarity. (b) If GUA of the transcribed mRNA is an intron, depict the sequence involved in the formation of mRNA /the mature processed hnRNA strand. (i) In a bacterium (ii) In humans (c) Upon translation, how many amino acids will the resulting polypeptide have? Justify. U + K [SQP 2023–24] Ans. (i) A-Template strand 1 B-Coding strand 1 Template strand has polarity 3’→ 5’ Coding strand has polarity 5’ → 3’ On the basis of polarity with respect to promoter. ½+½ U + Ap [Delhi Set-3, 2014; Delhi Set-2, Comptt. 2015] OR Describe Frederick Griffith’s experiment on Streptococcus pneumoniae. Discuss the conclusion U + A [Outside Delhi Set-2, 2014] he arrived at. (i) Identify strands ‘A’ and ‘B’ in the diagram of transcription unit given above and write the basis on which you identified them. (ii) S tate the functions of Sigma factor and Rho factor in the transcription process in a bacterium. (iii) W rite the functions of RNA polymerase-I and RNA polymerase-III in eukaryotes. Ap [Foreign Set-1, 2016] OR (i) Describe the various steps of Griffith’s experiment that led to the conclusion of the ‘Transforming principle’. (ii) How did the chemical nature of the ‘Transforming principle’ get established ? Ans. (a) Alfred Hershey and Martha Chase carried out their experiments to prove that DNA is the genetic material and not the protein. (b) (i) They used radioactive phosphorus (32P) and radioactive sulphur (35S). They grew some viruses on a medium that contained radioactive phosphorus and some others on a medium that contained radioactive sulphur. Viruses Molecular Basis of Inheritance s production of proteins. Bacterial transcription occurs in the cytoplasm alongside translation. The process of transcription is completed in three steps : Initiation, elongation and termination. (a) Initiation : The enzyme binds at the promoter site of DNA and initiates the process of transcription. It causes the local unwinding of the DNA double helix. In initiation, sigma factor ( ) present in RNA polymerase initiates the RNA synthesis. (b) Elongation : The RNA chain is synthesized in the 5’→ 3’ direction. RNA polymerase uses nucleoside triphosphate as substrate and polymerisation occurs according to complementarity. (c) Termination : Termination occurs when the termination factor (rho) alters the specificity of RNA polymerase to terminate the transcription. As the RNA polymerase proceeds to perform elongation, a short stretch of RNA remains bound to the enzyme. As the enzyme reaches 6. Describe the packaging of DNA helix in a the termination region, this nascent RNA falls prokaryotic cell and an eukaryotic nucleus. off and transcription is terminated. 3 K [Foreign Set-1, 2016] (ii) The precursor of mRNA i.e., hnRNA contains 7. (i) Describe the process of transcription in bacteria. both introns and exons. Introns are removed (ii) Explain the processing the hnRNA needs to and exons are joined by a process called undergo before becoming functional mRNA in splicing. The remaining mRNA is processed in eukaryotes. K [Outside Delhi Set-1, 2016] two ways : OR (a) Capping: Here, an unusual nucleotide called Explain the process of transcription in a prokaryote. methyl guanosine triphosphate (cap) is added to the 5’ end of hnRNA. U [Outside Delhi Comptt. 2017, Set-2] (b) Tailing: Here, adenylate residues (200–300) are added at the 3’ end of hnRNA in a template Concept Applied Synthesis of RNA independent manner. When hnRNA is fully processed, it is known as Ans. (i) Bacterial transcription is the process in which mRNA, which is transported out of the nucleus messenger RNA transcripts of genetic material to get translated. 2 in bacteria are produced to be translated for the 8. (a) Explain the process of DNA replication with the help of schematic diagram. (b) In which phase of the cell cycle does replication occur in eukaryotes? What would happen if cell-division is not followed after DNA replication? K [Delhi Comptt. Set-1, 2015] grown in the presence of radioactive phosphorus contained radioactive DNA but not radioactive protein because DNA contains phosphorus but protein does not. Similarly, viruses grown on radioactive sulphur contained radioactive protein but not radioactive DNA because DNA does not contain sulphur. (ii) Blender: To separate the viral protein coats that are still attached to the surface of bacteria. Centrifuge: To separate lighter supernatant (containing viral protein coats) from the denser residue (containing bacteria). 1 (iii) Observations: • Bacteria that were infected with viruses having radioactive DNA were found to contain radioactive DNA. • Bacteria that were infected with viruses having radioactive protein coat were not found to contain radioactivity. [Marking Scheme SQP 2023 – 24] – Replication of DNA begins at ori site to form a replication fork.½ – DNA dependant DNA polymerase forms a new strand in 5’ → 3’ direction.½ – Role of DNA ligase is to join discontinuously synthesised fragments.½ Ans. (a) (b) S-phase. Polyploidy This Question is for practice and its solution is given at the end of the chapter. 2½ ½ [Marking Scheme, 2014] ½ BIOLOGY, Class-XII TOPIC-2 Genetic Code, Translation, Lac Operon, HGP and DNA Fingerprinting Concepts Covered Genetic code Translation Gene expression Lac Operon HGP Rice Genome Project Steps and application of DNA Fingerprinting Revision Notes [Board, 2019] The relationships between genes and DNA are best understood by mutation studies. Effects of large deletions and rearrangements in a segment of DNA may result in loss or gain of a gene and so a function. A classical example of point mutation is a change of single base pair in the gene for beta globin chain of haemoglobin that results in the change of amino acid ¾ ¾ ¾ The Adaptor Molecule – tRNA The tRNA is a molecule that has about 60% of its part double-stranded and the rest remains single stranded which has unpaired bases. The tRNA has (a) An anticodon (NODOC) loop that has bases complementary to the CODON with which it gets attached in mRNA. (b) An amino acid acceptor end to which amino acid binds. This end or site lies at the 3' end & CCA– OH group. The 5' end bears G. (c) T Y C loop : This is the site for attaching with the ribosome. This has some unusual bases like Y (pseudouridine) and ribothymidine. (d) DHU-Loop : It is the binding site for the enzyme aminoacyl synthetase. It is the largest loop and has Dihydrouridine. (e) Extra arm : It is a variable side arm lying between T Y C and anticodon loop. tRNA is called an adaptor molecule because it picks up amino acids from the cytoplasm and transfers them to ribosomes during protein synthesis. For initiation, there is another tRNA called initiator tRNA. There are no tRNAs for stop codons. 2-D structure of tRNA looks like a clover-leaf according to Robert Holly (1965). The 3-D structure looks like inverted ‘L’ according to Klug (1974). ¾ Translation – Protein Synthesis It takes place in ribosomes. It includes 4 steps : 1. Charging of tRNA (aminoacylation of tRNA) • Formation of a peptide bond requires energy obtained from ATP. • For this, amino acids are activated (amino acid + ATP) and linked to their cognate tRNA in the presence of aminoacyl tRNA synthetase. So, the tRNA becomes charged. 2. Initiation • It begins at the 5’-end of mRNA in the presence of an initiation factor. • The mRNA binds to the small subunit of the ribosome. Now the large subunit binds to the small subunit to complete the initiation complex. ¾ ¾ ¾ ¾ ¾ Genetic Code: It is the sequence of nucleotides in mRNA that contains information for protein synthesis (translation). ¾ 20 amino acids are involved in translation. George Gamow: Suggested that for coding 20 amino acids, the code should be made up of 3 consecutive nucleotides. Har Gobind Khorana: Developed the chemical method in synthesising RNA molecules with defined combinations of bases (homopolymers and copolymers). Marshall Nirenberg : Developed a cell-free system for protein synthesis. Severo Ochoa (polynucleotide phosphorylase) enzyme is used to polymerise RNA with defined sequences in a template-independent manner. ¾ Salient Features of Genetic Code The genetic code is a triplet code (three-letter code) where three adjacent nitrogen bases code for a single amino acid. 61 codons code for amino acids. 3 codons (UAA, UAG and UGA) do not code for any amino acids. They function as stop codons (Termination codons or nonsense codons). Genetic code is universal e.g., From bacteria to human UUU codes for Phenylalanine. Some exceptions are found in mitochondrial codons and in some protozoans. No punctuations between adjacent codons (comma less code). The codon is read in mRNA in a continuous fashion. Genetic code is non-overlapping. A single amino acid is represented by many codons (except AUG for methionine and UGG for tryptophan). Such codons are called degenerate codons. Genetic code is unambiguous and specific. i.e., one codon specifies for only one amino acid. The codon is read in the 5' ® 3' direction. AUG has dual functions. It codes for Methionine (met) and also acts as an initiator codon. In eukaryotes, methionine is the first amino acid and formyl methionine is the first amino acid in prokaryotes. ¾ Mutations and Genetic Code residue glutamate to valine. It results into a diseased condition called sickle cell anaemia. Insertion or deletion of one or two bases changes the reading frame from the point of insertion or deletion. When there is shifting of the reading frame due to insertion or deletion of the nucleotide, such mutation is known as frameshift mutation. This forms the genetic basis of proof that the codon is a triplet and is read in a continuous manner. Molecular Basis of Inheritance MNEMONICS ¾ ¾ ¾ ¾ ¾ ¾ b ¾ Concept: Translation process (It include 4 steps) Mnemonics: Come In Evening Time Interpretations: Charging of tRNA, Initiation, Elongation, Termination time. However, there are housekeeping genes that are always expressed in the cell. The metabolic, physiological and environmental conditions regulate the expression of genes. e.g., In E. coli, the enzyme beta-galactosidase hydrolyses lactose into galactose and glucose. In the absence of lactose, the synthesis of beta-galactosidase stops. The development and differentiation of an embryo into an adult the result of the regulation of several set of genes. Operon Concept : This is a regulatory system that is observed in bacteria where a group of gene control a metabolic pathway. “Each metabolic reaction is controlled by a set of genes”. All the genes regulating a metabolic reaction constitute an Operon e.g., lac operon, trp operon, ara operon, his operon, val operon etc. When a substrate is added to growth medium of bacteria, a set of genes is switched on to metabolize it. This is called induction. When a metabolite (product) is added, the genes to produce it are turned off. This is called repression. The Lac Operon Lac operon in E. coli : The operon controlling lactose metabolism. It consists of a regulator gene, 3-structural genes, an operator gene, promoter gene, a repressor and an inducer. (a) A regulatory or inhibitor gene : Codes for the repressor. (b) 3 structural genes : (i) z gene : Codes for -galactosidase (hydrolyze lactose to galactose and glucose). (ii) y gene : Codes for permease (increase permeability of the cell to lactose). (iii) a gene : Codes for a transacetylase. The genes present in the operon function together in the same or related metabolic pathway. There is an operator region for each operon. If there is no lactose (inducer), lac operon remains switched off. In the absence of inducer, repressor gene is active. The regulator gene synthesizes mRNA to produce the repressor protein, this protein binds to the operator genes and blocks RNA polymerase movement. So, the structural genes are not expressed. In the absence of glucose, If lactose is provided in the growth medium, the lactose is transported into the E. coli cells by the action of permease. Lactose (inducer) binds with repressor protein. So, repressor protein cannot bind to operator gene. The operator gene becomes free and induces the RNA polymerase to bind with promoter gene then transcription starts. Regulation of lac operon by repressor is called negative regulation. Transport of mRNA from the nucleus to the cytoplasm. Translational level. Importance of regulation of gene expression: Gene regulation is the process to switch off or switch on the genes as per the requirement of the organism. Gene regulation is required so that there is no waste of energy in expressing the genes not required at the ¾ ¾ ¾ • Large subunit has 2 binding sites for tRNAaminoacyl tRNA binding site (A site) and peptidyl site (P site). • Initiation codon for methionine is AUG. So, methionyl tRNA complex would have UAC at the anticodon site. 3. Elongation • At the P-site the first codon of mRNA binds with anticodon of methionyl tRNA complex. • Another aminoacyl tRNA complex with an appropriate amino acid enters the ribosome and attaches to A site. • Its anticodon binds to the second codon on the mRNA and a peptide bond is formed between first and second amino acids in presence of an enzyme, peptidyl transferase. • The uncharged tRNA moves from the P site to the E site and the peptidyl-tRNA moves to the P site. This is called a translocation. • Then 3rd codon comes into A site and a suitable tRNA with 3rd amino acid binds at the A site. This process is repeated. • A group of ribosomes associated with a single mRNA for translation is called a polyribosome (polysomes). • A ribozyme is a ribonucleic acid (RNA) enzyme that catalyses a chemical reaction. The ribozyme catalyses specific reactions in a similar way to that of protein synthesis. Also called catalytic RNA, ribozyme are found in ribosome where they join amino acids together to form protein chains. 4. Termination • When aminoacyl tRNA reaches the termination codon like UAA, UAG & UGA, the termination of translation occurs. The polypeptide and tRNA are released from the ribosomes. • The ribosome dissociates into large and small subunits at the end of protein synthesis. An mRNA has additional sequences that are not translated (untranslated regions or UTR). UTRs are present at both 5’-end (before start codon) and 3’-end (after stop codon). They are required for an efficient translation process. Regulation of Gene Expression Gene expression results in the formation of a polypeptide. In eukaryotes, the regulation includes the following levels : Transcriptional level (formation of primary transcript). Processing level (regulation of splicing). Human Genome Project (HGP) [Board, 2017, 2023] The entire DNA in the haploid set of chromosome of an organism is called a Genome. In human genome, DNA is packed in 23 chromosomes. Human Genome Project (1990–2003) is the first effort in identifying the sequence of nucleotides and mapping of all the genes in the human genome. BIOLOGY, Class-XII ¾ ¾ ¾ ­ ­ ¾ ¾ About 1.4 million locations where single-base DNA differences (SNPs- Single nucleotide polymorphism or ‘snips’) occur in humans. ¾ Rice Genome Project Rice is one of the most largely consumed foods in India. Also, the population is increasing with a rapid pace, so, to meet this requirement, Rice genome project has been launched to increase the production of rice. Rice has the smallest genome of 430Mb nucleotides located on chromosome 12. ¾ Rice Genome : It is a joint project of National Institute of Aerobiological Sciences (NIAS), forestry and fisheries (STAFF), Ministry of Agriculture, Forestry and Fisheries (NAFF), Society for Techno-innovation of Agriculture genome research program. Arabidopsis is an experiment plant of rice genome because it has fast life cycle and can be easily grown. It has smaller genome and high diversity and helps in enhancing the molecular products. Need for sequencing rice genome: To know the functioning of genes by accurate gene sequencing. It is important for agronomic traits which requires mapping of genomic sequences. Improvement of other cereals will become easier. ¾ DNA Fingerprinting (DNA profiling) [Board, 2020] It is the technique to compare the DNA fragments of two individuals. Developed by Alec Jeffreys (1985). He is considered as the father of DNA fingerprinting. Lalji Singh is the Father of Indian DNA fingerprinting. ¾ Basis of DNA Fingerprinting [Board, 2017] DNA carries some non-coding sequences called repetitive sequence [Variable Number of Tandem Repeats (VNTR)]. Number of repeats is specific. It varies from person to person and is specific to a person. The size of VNTR varies from 0.1 to 20 kb. Repetitive DNA is separated from bulk genomic DNA as different peaks during density gradient centrifugation. The bulk DNA forms a major peak and the other small peaks are called satellite DNA. Satellite DNA is classified into many categories (microsatellites, mini-satellites, etc.) based on the base composition (A-T rich or G-C rich), length of segment and number of repetitive units. An inheritable mutation observed in a population at high frequency is called DNA polymorphism (variation at genetic level). Polymorphism is higher in noncoding DNA sequence. This is because mutations in these sequences may not have any immediate effect on an individual’s reproductive ability. These mutations accumulate generation after generation and cause polymorphism. For evolution & speciation, polymorphisms play an important role. ¾ ¾ ¾ ¾ ¾ ¾ Goals of HGP (a) To identify all the estimated genes in human DNA. (b) To determine the sequences of the 3 billion chemical base pairs that make up human DNA. (c) To store this information in databases. (d) To improve tools for data analysis. (e) To transfer related technologies developed during the project of society to other sectors of society. (f) To address the Ethical, Legal and Social Issues (ELSI) that may arise from the project. ¾ HGP was Closely Associated with Bioinformatics The application of computer science and information technology to the field of biology and medicine helps in analysing DNA sequence data. ¾ Methodologies of HGP There are two major approaches namely, ESTs and sequence annotation. Expressed Sequence Tags (ESTs) : Focused on identifying all the genes that are expressed as RNA and sequencing the same. Sequence annotation : Sequencing whole set of the genome containing all the coding & non-coding regions and later assigning functions to different regions. ¾ Procedure : Isolate total DNA from a cell → Convert into random fragments of smaller size → Clone in suitable host (e.g., BAC – bacterial artificial chromosomes & YAC – yeast artificial chromosomes) for amplification through PCR (polymerase chain reaction) → Fragments are sequenced using Automated DNA sequencers (using Frederick Sanger method) → Sequences are arranged based of the overlapping regions → Alignment of sequences using computer-based programs → Genetic and physical maps on the genome were generated using the information on polymorphism of restriction endonuclease recognition sites and some repetitive DNA sequences (micro-satellites). ¾ Salient Features of Human Genome (a) Human genome contains 3164.7 million nucleotide bases pairs. (b) Total number of genes = about 25,000. (c) Average gene consists of 3000 bases, but sizes vary. The largest known human gene (dystrophin on X-chromosome) contains 2.4 million bases. (d) 99.9% of nucleotide bases are identical in all people. It is 0.1% which makes each of us unique. (e) Functions of over 50% of discovered genes are unknown. (f) Chromosome I has the most genes (2968) and Y has the fewest (231). (g) Less than 2% of the genome codes for proteins. (h) Repeated sequences make up a very large portion of the human genome. Repetitive sequences are stretches of DNA sequences that are repeated many times. They have no direct coding functions but they shed light on chromosome structure, dynamics and evolution. (i) Human genome contains about 3 × 10 bp. ¾ Steps of DNA Fingerprinting (Southern Blotting Technique) (a) Isolate DNA (from any cells like blood stains, semen stains or hair roots). ¾ 9 Molecular Basis of Inheritance the DNA fragment on the membrane to form a hybridized DNA. (h) The filter paper is washed to remove unbound probe. (i) The hybridised DNA is photographed on to an X-ray film by autoradiography. The image (in the form of dark & light bands) obtained is called a DNA fingerprint. This gives the characteristic pattern of an individual's DNA. ¾ ¾ Applications of DNA Fingerprinting are : Forensic tool to solve paternity, rape, murder, etc. For the diagnosis of genetic diseases. To determine the phylogenetic status of animals. (b) Make copies (amplification) of DNA by Polymerase Chain Reaction (PCR) if the amount of isolated DNA is small. (c) Digest DNA by restriction endonucleases. (d) Separate DNA fragments by gel electrophoresis over agarose polymer gel. (e) Treat with alkali solution (NaOH) to denature DNA bonds so as to split them into singlestranded DNAs in the gel. (f) Transfer (blotting) single-stranded DNA fragments to synthetic membranes such as nitrocellulose or nylon, and then baked in a vacuum oven at 80°C for 3-5 hours (to fix the DNA fragment on the membrane). (g) Nitrocellulose filter membrane is placed in a solution containing a radioactive labelled singlestranded DNA probe. The DNA probes are small radioactive synthetic DNA segments of known sequences of nitrogen bases. These DNA probe binds with the complementary sequences of KEY-TERM VNTR: Variable Number of Tandem Repeats KEY FACT ¾ ¾ D NA finger printing is based upon principle of polymorphism in DNA sequence. IMPORTANT DIAGRAMS : Tyr Bor AG G Ser tRNA Brr 5' U C A Anticodon A G U Codon AUG U C A mRNA CUCUUGGGUCCGCAGUUUAA 3' 5' Fig 5.12: tRNA- the adapter molecule P I P O 3' Fig 5.13: Translation Z Y A In absence of inducer Repressor binds to the operator Repressor mRNA region (o) and prevents RNA polymerase from transcribing the operon Repressor P I P O Z Y A In presence of inducer Transcription Repressor mRNA lac mRNA Translation Permease -Glactosidse Transacetylase (Inactive repressor) Inducer Fig 5.14: The lac Operon BIOLOGY, Class-XII Example-2 Q. When does lac operon get switched off ? Sol. The lac operon comprises of one regulatory gene or inhibitor gene (i), are promoter gene, one operator gene and three structural genes. Regulator gene codes for a protein known as repressor protein, it is synthesised all the time from the i-gene. The operon gets switched off when repressor protein produced by regulatory or inhibitor gene binds to operation gene. RNA polymerase gets blocked, so there is no transcription. Repressor protein + Operator gene → Switched off SUBJECTIVE TYPE QUESTIONS (1 mark each) 1. Name different components which are part of transcription unit in DNA. [OEB] K Regulation of Genen Expression Ans. The segment of DNA that takes part in transcription is called transcription unit. It has three components (i) a promoter, (ii) the structural gene, (iii) a terminator. 1 2. Mention two applications of DNA-polymorphism. K [Foreign Set-1, 2016] 3. Which property of genetic code is utilised in Wobble hypothesis? U Concept Applied Genetic code Ans. Degeneracy of genetic code is utilised in wobble hypothesis. 1 4. Name the site, where during transcription, RNA polymerase binds to the DNA. [OEB] K Short Answer Type Questions-I (2 marks each) 1.State the roles of AUG codon at 5' end and UAG at 3' end of a certain m-RNA during translation. Ans. Concept Applied Translation Concept Applied 3. Following are the features of genetic codes. What does each one indicate ? Stop codon, Unambiguous codon, Degenerate codon, Universal codon. U [Outside Delhi Set-1, 2016] Detailed Answer : The features of genetic codes are : (i) Stop codon : Termination codons or stop codons are UAA, UAG and UGA. They do not code for any amino acids. They represent the termination of translation. (ii) Unambiguous codon : The genetic code is specific and non-ambiguous i.e., one codon specifies only one amino acid. (iii) Degenerate codon : This indicates that a single amino acid is represented by more than one codons. (iv) Universal codon : This indicates that one codon codes for the same amino acid in all species. From bacteria to human, UUU codes for phenyl alanine. ½×4=2 4. Differentiate between the features of genetic code given below : (a) Unambiguous and Universal (b) Degenerate and Initiator U [Outside Delhi, 2017, Set-1, 2, 3] Very Short Answer Type Questions (a) K [Delhi Comptt. - 2017, Set-1, 2, 3] Ans. AUG codon at 5' end = Start codon (for translation)/ codes for methionine. 1 UAG codon at 3' end = Stop codon (for translation)/terminate polypeptide chain. 1 [Marking Scheme, 2017] 2. Explain when is a genetic code said to be (a) Degenerate (b) Universal Ap [Delhi Set-1, 2020] OR Unambiguous Universal One codon codes Genetic code or codons for only one amino are (nearly) same for acid all organisms or from bacteria to human Degenerate Initiator (b) More than one Start codon or AUG codon code for the same amino acid. Topper's Answer, 2017 This Question is for practice and its solution is given at the end of the chapter. Molecular Basis of Inheritance 5. What is aminoacylation ? State its significance. K [Outside Delhi Set-II, 2016] Concept Applied Translation Short Answer Type Questions-II (3 marks each) Ans.(a) (i) Point mutation/ single base substitution½ (ii) Point mutation/ single base deletion½ (b) (i) 4 amino acids1 (ii) 4 amino acids 1 [Marking Scheme, 2020] 2. (a) Study the table given below and identify (i), (ii), (iii) and (iv) Amino acid Phe Val This Question is for practice and its solution is given at the end of the chapter. CAC Codon in mRNA (i) (ii) Anticodon in tRNA (iii) (iv) A T G C A T G C A T G C 5’ “RNA molecule” U [Delhi Set-1, 2019] Concept Applied Transcription Ans. Transcription is catalyzed by DNA dependent RNA polymerase. As RNA have uracil at the place of thymine, the given sequence is coding strand of DNA and not the RNA strand. However, considering this coding sequence of DNA, for the given RNA the transcription unit will be : [Template strand] 3’ T A C G T A C G T A C G 5’ 5’ A T G C A T G C A T G C 3’ [Coding strand] ↓ mRNA 5’ A U G C A U G C A U G C 3’ 3 4. A criminal blew himself up in a local market when he was chased by cops. His face was beyond recognition. Suggest and describe a modern technique that can help establish his identity. Ap [Delhi, 2017, Set-2] OR A number of passengers were severely burnt beyond recognition during a train accident. Name and describe a modern technique that can help establish their identity. Ap [Delhi, 2017, Set-1] OR During a fire in an auditorium, a large number of assembled guests got burnt beyond recognition. 1. A small stretch of DNA strand that codes for a polypeptide is shown below : 3' ..........CAT CAT AGA TGA AAC ........... 5' (a) Which type of mutation could have occurred in each type resulting in the following mistakes during replication of the above original sequence? (i) 3`… … … …CAT CAT AGA TGA ATC… … …5` (ii) 3`… … … …CAT ATA GAT GAA AC… … … 5` (b) How many amino acids will be translated from each of the above strands (i) and (ii) ? Ap [SQP, 2020-21] AAA (b)A polypeptide consists of 14 different amino acids. (i) How many base pairs must be there in the processed mRNA that codes for this polypeptide? (ii) How many different types of tRNA are needed for the synthesis of this polypeptide? K [SQP 2020] 3. Construct and label a transcription unit from which the RNA segment given below has been transcribed. Write the complete name of the enzyme that transcribed this RNA. Ans. Aminoacylation is the process of adding an activated amino acid to the acceptor arm of a transfer RNA. It is an essential step for the synthesis of protein as it activates the amino acids (amino acid + ATP) and helps in linking them to their cognate tRNA in the presence of an enzyme aminoacyl tRNA synthetase. 1+1=2 6. Study the figure below and answer the following questions: (a) Name the process depicted in the figure. Define it. (b) Name the subunits of Ribosome. U [SQP 2023 – 24] Ans: (a) This process is known as translation. Translation involves decoding a messenger RNA (mRNA) to be translated into amino acids. Amino acids are linked together to build a polypeptide. (b) Ribosomes consist of two major components: the small ribosomal subunit, which reads the RNA, and the large subunit, which joins amino acids to form a polypeptide chain. DNA code in gene Suggest and describe a modern technique that can help hand over the dead to their relatives. Ap [Delhi, 2017, Set-3] BIOLOGY, Class-XII Concept Applied DNA Fingerprinting DNA with fragments ranging from 200 base pairs to 2500 base pairs was electrophoresed on agarose gel with the following arrangement. U [SQP, 2022-23] Ans. DNA fingerprinting is the technique of determination of nucleotide sequence of certain areas of DNA, which are unique to each individual. Step/Procedure in DNA Fingerprinting : (i) Extraction of DNA — using high speed refrigerated centrifuge. (ii) Amplification — many copies are made using PCR. (a) What result will be obtained on staining with ethidium bromide? Explain with reason. (b) The above set-up was modified and a band with 250 base pairs was obtained at X. (iii) Restriction Digestion → using restriction (iv) Separation of DNA fragments → using enzymes DNA is cut into fragments. electrophoresis agarose polymer gel. (v) Southern → Blotting Separated DNA sequences are transferred to nitrocellulose or nylon membranes. (vi) Hybridisation → The nylon membranes exposed to radioactive probes. (vii) Autoradiography → The dark bands develop at the probe site. (viii) Matching the banding pattern so obtained with that of the relative. 5. (a) How does mutation occur ? What change(s) were made to the previous design to obtain a band at X? Why did the band appear at the position X? shift mutation. Ans. (a) No bands will be obtained as/All DNA will be U [Outside Delhi, Set-1, 2019] seen in the well only; [½] Ans. (a) Loss (deletion) or gain (insertion / duplication DNA fragments being negatively charged will /addition) or change in position of DNA not move towards negative end/ cathode. DNA segments /chromosome 1 being negatively charged will remain stationed (b) mutation due to change in a single base pair at the positive end/ anode end of the agar block; of DNA is point mutation, 1 [1] Insertion or deletion of one or two bases (b) (i) Position of the positive terminal/ end/ anode changes the reading frame from the point of and the negative terminal/ end/ cathode was insertion or deletion. 1 inter-changed. [½] (ii) The fragment with least base pairs will get [Marking Scheme, 2019] separated faster and move faster toward the a 6. Carefully observe the given picture. A mixture of node end. 7. (a) Explain VNTR and describe its role in DNA fingerprinting. (b) List any two applications of DNA fingerprinting technique. Ap [Outside Delhi/Delhi, 2018] (b) Differentiate between point mutation and frame Topper's Answer, 2018 Molecular Basis of Inheritance (a) List the two methodologies which were involved in human genome project. Mention how they were used. (b) Expand ‘YAC‘ and mention what was it used for. C [Delhi 2017] 8. Concept Applied Human Genome Project Topper's Answer, 2017 Ans. Ans: (a) The four prime goals of Human Genome Project were: To determine the complete nucleotide sequence of the human genome. 9. Human Genome Project (HGP) was a mega project launched in the year 1990 with some important goals. (a) Enlist any four prime goals of HGP. (b) Name any one common non-human animal model organism which has also been sequenced thereafter. U [Delhi Set-1, 2023] 3 To identify all the genes present in the human genome. To study the function of each gene in the human genome. To develop new technologies and tools for analyzing and understanding genomic data. (b) One common non-human animal model organism that has also been sequenced is the mouse (Mus musculus). [Marking Scheme, Delhi, 2023] BIOLOGY, Class-XII (5 marks each) 1. (a) Name the type of DNA that forms the basis of DNA fingerprinting and mention two features of this DNA. (b) Write the steps carried out in the process of DNA fingerprinting technique and mention its application. K [Outside Delhi Set-2, 2020] Concept Applied DNA Fingerprinting Ans. (a) The variation between individuals in the lengths of their DNA satellites forms the basis of DNA fingerprinting. Features of DNA satellites : (i) They are divided into minisatellites and microsatellites whose characteristic makes them simple for identification between two samples as the DNA is polymorphic. It was called as Variable Number Tandem Repeats (VNTR). (ii) They are also inheritable from parents to offspring and can be used for paternity testing. (b) Steps of DNA fingerprinting are : Isolation of DNA (From any cells like blood stains, semen stains or hair roots). Make copies (amplification) of DNA by polymerase chain reaction (PCR). Digestion of DNA by restriction endonucleases. Separation of DNA fragments by gel electrophoresis. Transferring (blotting) of separated DNA fragments to synthetic membranes, such as nitrocellulose or nylon and then baked in a vacuum oven at 80°C for 3–5 hours (to fix the DNA fragment on the membrane). Double stranded DNA made single stranded. Hybridisation using labelled VNTR probe. Detection of hybridized DNA fragments by autoradiography. After hybridisation with VNTR probe the autoradiogram gives many bands of different sizes. These bands give a characteristic pattern for an individual DNA. It differs from individual to individual. The image (in the form of dark & light bands) obtained is called DNA fingerprint. The DNA from a single cell is enough to perform DNA fingerprinting. Application of DNA fingerprinting It is used in forensic science to identify potential crime suspects. It is used to establish paternity and family relationships. It is used to identify and protect the commercial varieties of crops and livestock. It is used to find out evolutionary history of an organism and trace out the linkages between various groups of organisms. (Any two) 2+2+1 2. (a) List any four major goals of Human Genome project. This Question is for practice and its solution is given at the end of the chapter. (b) Write any four ways the knowledge from HGP is of significance for humans. (c) Explain BAC and mention its importance. K [Delhi Set-1, 2020] 3. The lac operon is a polycistronic gene that helps a bacterial cell in metabolising lactose. It consists of an inducer (i) gene that represses the transcription of lac genes under certain environmental conditions. (a) Why is the lac gene called polycistronic? (b) What would happen if there was a mutation blocking the translation of: (i) gene z (ii) gene y (c) What happens to the expression of the lac operon when the growth medium is provided with: (i) both glucose and lactose (ii) only galactose U [CFPQ] Ans: (a) It has a single promoter for multiple connected genes. OR A single mRNA is transcribed to be translated to multiple proteins. (b) 1 mark each for the following: (i) Lactose would not be able to enter/permeate into the bacterial cell. (ii) Lactose would enter the cell but not be broken down into glucose and galactose. (c) 1 mark each for the following: (i) Glucose is the preferred carbon source is consumed first while lactose induces the lac operon producing small levels of the lac proteins. (ii) In the absence of lactose, the repressor protein will continue binding to the operator of the lac operon preventing transcription of its genes. 4. Summarize the process by which the sequence of DNA bases in Human Genome Project was determined using the method developed by Frederick Sanger. Name a free living nonpathogenic nematode whose DNA has been completely sequenced. U [SQP 2020-21] Long Answer Type Questions Concept Applied Human Genome Project Ans. Frederick Sanger developed a method to sequence fragments, using automated DNA sequencers. On the basis of overlapping regions on DNA fragments, these sequences are arranged. For alignment of these sequences, computer-based programs were used. Finally, by using the information on polymorphism of restriction endonuclease recognition sites and certain repetitive DNA sequences, the genetic and physical maps of the genome were generated Caenorhabditis elegans.4 5. (a) Write the contributions of the following scientists in deciphering the genetic code. Molecular Basis of Inheritance Ans. Mechanism of translation : (a) Charging of tRNA (Aminoacylation of tRNA): Here, amino acids are activated (amino acid + ATP) and linked to their cognate tRNA in the presence of aminoacyl tRNA synthetase. This process is commonly known as charging of tRNA or aminoacylation of tRNA. If two such charged tRNAs are brought close enough, the formation of peptide bonds between them would be favoured energetically. This is an essential step as only activated amino acids are carried to the site of protein synthesis by their respective tRNA. (b) Translation is initiated by formation of an initiation complex consisting of 30S ribosomal subunit, formyl-methionyl (fMet) tRNA, and mRNA. It begins at the 5’-end of mRNA in the presence of an initiation factor. The mRNA binds to the small subunit of ribosome. AUG is recognised by the initiator tRNA. The initiation codon for methionine is AUG. So methionyl tRNA complex would have UAC at the Anticodon site. Now the large subunit (50S) binds to the small subunit to complete the initiation complex. Large subunit (70S) has two binding sites to which tRNA-carrying amino acids can bind. One is called aminoacyl tRNA binding site (A site) and the other is called peptidyl site (P site). There is also a third site called the exit or E site where tRNAs are released. (c) An mRNA has additional sequences that are not translated (untranslated regions or UTR). UTRs are present at both 5’-end (before start codon) and 3’-end (after stop codon). They are required for an efficient translation process. [Marking Scheme SQP 2023 – 24] 7. (i) What do ‘Y’ and ‘B’ stand for in ‘YAC’ and ‘BAC’ used in Human Genome Project (HGP). Mention their role in the project. (ii)Write the percentage of the total human genome that codes for proteins and the percentage of discovered genes whose functions are known as observed during HGP. (iii) Expand ‘SNPs’ identified by scientists in HGP. K [Outside Delhi Set-1, 2016] Ans. (i) YAC (Yeast Artificial Chromosomes) and BAC (Bacterial Artificial chromosomes) are cloning vectors. They are used in Human genome project for cloning or amplification of human DNA fragments. (ii) Total number of genes (coding for protein) in the human genome is 30,000 which is less than 2% of the total genome and almost 50% of the discovered genes have unknown functions. (iii) SNPs stand for Single Nucleotide Polymorphism. George Gamow; Har Gobind Khorana; Marshall Nirenberg; Severo Ochoa. (b) State the importance of a Genetic code in protein synthesis K [Delhi, Set-1, 2019] Ans. (a) George Gamow : He suggested that in order to code for all the 20 amino acids, the code should be made up of three nucleotides. This is because a permutation combination of 43 (4 × 4 × 4) would generate 64 codons; generating many more codons than required. So, the codon was proposed to be a triplet. Har Gobind Khorana : He developed a chemical method to synthesise RNA molecules with defined combinations of bases (homopolymers and co-polymers). Marshall Nirenberg : He developed a cell-free system for protein synthesis which helped the code to be deciphered. Severo Ochoa : He discovered an enzyme (polynucleotide phosphorylase), which helped in the synthesis of RNA with defined sequences in a template-independent manner (enzymatic synthesis of RNA). (b) The genetic code consists of the sequence of nitrogenous bases in the DNA. Translation of the nitrogenous base code to an amino acid sequence in a protein is the basis for protein synthesis. Thus, correct translation is important for protein biosynthesis. 4+1 6. (a) Explain the process of amino-acylation of tRNA and its role in the process of translation. (b) How does the initiation of the translation process occur in prokaryotes? Explain. (c) Where are the untranslated regions located on m-RNA and why? [SQP 2023 – 24] OR Explain the mechanism of translation that occurs in the ribosomes in a prokaryote. U [Outside Delhi 2019, Set-1, 2] OBJECTIVE TYPE QUESTIONS (1 mark each) [A] Multiple Choice Questions 1. Taylor and colleagues performed experiments on ............. using radioactive ........... to prove that the DNA in chromosomes replicate semi-conser vatively. [Term-I 2021] U This Question is for practice and its solution is given at the end of the chapter. Select the correct option for the blanks. (A) Vicia faba, Uridine (B) E. coli, Uridine (C) Vicia faba, Thymidine (D) E coli, Thymidine BIOLOGY, Class-XII Ans. Option (C) is correct. Explanation: In 1958, Taylor and colleagues performed experiments on Vicia faba using radioactive thymidine to prove that the DNA in chromosomes replicate semi-conservatively. (i) (ii) (iii) (iv) Select the option which is incorrectly representing the experiment. (A) (i) and (iii) (B) (ii) and (iii) (C) (iii) and (iv) (D) (ii) and (iv) Ans. Option (C) is correct. Explanation : Griffith (1928) used mice and a bacterial strain, Streptococcus pneumoniae. Streptococcus pneumoniae has two strains : (a) Smooth (S) strain (Virulent) : Has polysaccharide mucous coat. Causes pneumonia. (b) Rough (R) strain (Non-virulent) : No mucous coat. Does not cause pneumonia. Experiment • S-strain → Inject into mice → Mice die • R-strain → Inject into mice → Mice live • S-strain (Hk) → Inject into mice → Mice live • S-strain (Hk) + R-strain (live) → Inject into mice → Mice die He concluded that there exists some ‘transforming principle’, that is transferred from heat-killed S-strain to R-strain. It enabled R-strain to synthesize smooth polysaccharide coat and become virulent. This must be due to the transfer of genetic material. Ans. Option (B) is correct. Explanation: The genetic code is degenerate, meaning that multiple codons can code for the same amino acid. This redundancy in the genetic code makes it challenging to determine the exact mRNA sequence solely based on the protein sequence. 6. Which one of the following diagram correctly represents DNA replication in eukaryotes? [SQP 2023 – 24] 2. Histone proteins that help in forming the nucleosomes in the nucleus are rich in basic amino acids such as K [Delhi Term-I 2021] (A) Arginine & tyrosine (B) Lysine & histidine (C) Arginine & Lysine (D) Histidine & Tryptophan 3.The reactive hydroxyl group in the nucleotide of RNA is [Delhi Term-I 2021] K (A) 5' OH (B) 4' OH (C) 2' OH (D) 3' OH 4. Study the given diagrammatic representation of Griffith's experiment to demonstrate transfor­ mation in bacteria. [Delhi Term-I 2021] U 5. Arun thinks that identifying the exact mRNA sequence from the protein sequence is difficult. Is he correct and why? (a) No, as the genetic code is universal. (b) Yes, as the genetic code is degenerate. (c) No, as the mRNA is translated into a protein sequence. (d) Yes, as the mRNA contains introns which are non-coding sequences. K [APQ 2023 – 24] (A) (B) (C) (D) Ans. Option (A) is correct. Explanation : DNA replication take place in the 5' to 3' direction because DNA polymerase acts on the 3'-OH of the existing strand for adding free nucleotides. 5' 3' Template DNA (patental strands) A B Continuous synthesis 3' 5' Discontinuous synthesis C 3' 5' 7. Which of the following statements about Untranslated regions is/are true? I. present on rRNA II. present on mRNA at 3’ position only III. present on mRNA at 5’ position only IV. present on mRNA at both 3’ and 5’position V. not required in translation process. Molecular Basis of Inheritance Ans. Option (A) is correct. Explanation : As mRNA is formed from template strand hence, the sequence of mRNA is complementary to template strand. 10. A DNA molecule is 160 base pairs long. If it has 20% adenine, how many cytosine bases are present in this DNA molecule? [SQP 2023–24] K (A) 48 (B) 64 (C) 96 (D) 192 Ans. Option (C) is correct. Explanation : No. of bases in 160 base pairs = 160 × 2 = 320 bases. Given, Adenine (A) = 20% = 20/100 × 320 = 64 bases As, Adenine (A) = Thymine (T) therefore; T = 64 bases A + T = 64 +64 = 128 bases Total bases of Cytosine (C) and Guanine (G) This Question is for practice and its solution is given at the end of the chapter. Ans. Option(A) is correct. Explanation: DNA, B. H1 histone, C. Histone octamer A B C 12. Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation. 1 3' AUCAGGUUUGUGAUGGUACGA 5 ' K [Delhi Set-1, 2023] (A) Phenylalanine, Methionine. (B) Cysteine, Glycine (C) Alanine, Proline (D) Serine, Valine K Ans. Option (C) is correct. Explanation : In the presence of an inducer, such as lactose or allolactose, the repressor is inactivated by interaction with the inducer. As lactose binds itself to active repressor and changes its structure, the repressor fails to bind to the operator. The RNA polymerase starts transcription of operon by binding to the promoter site of the promoter and transcription proceeds. 9. A template strand in a bacterial DNA has the given base sequence: 5' – AGGTTTAACG – 3' What would be the RNA sequence transcribed from this template strand ? [Term-I 2021] (A) 5' – CGUUAAACCU – 3' (B) 5' – TCCAAATTGC – 3' (C) 5' – AGGUUUUUCG – 3' (D) 5' – AGGTTTAACG – 3' = 320 – 128 = 192 bases As, C = G hence, the number of cytosine bases present in this DNA molecule is = 192/2 = 96 bases 11. Identify A, B and C in the given diagram. [APQ 2023 – 24] (A) A. DNA, B. H1 histone, C. Histone octamer (B) A. Histone octamer, B. DNA, C.H1 histone (C) A. DNA, B. Histone octamer, C. H1 histone (D) A. Histone octamer, B. H1 histone, C. DNA Ans. Option (A) is correct. Explanation: Codons UUU and AUG represent the amino acids phenylalanine and methionine, respectively. Therefore, during the process of translation, the amino acids phenylalanine and methionine would be merged at codon positions 3 and 5, accordingly. 13. Identify the correct pair of codon with its corresponding pair of amino acids [Term-I 2021] K (A) UAA: Leucine (B) UGA: Serine (C) AUG: Histidine (D) UUU: Phenylalanine 14. ‘A codon is a Triplet of bases’ was suggested by: (A) Marshall Nirenberg (B) Har Gobind Khorana (C) George Gamow (D) Francis Crick K [SQP 2023–24] Ans. Option (D) is correct. Explanation: These UTRs are positioned at both the 3' and 5' ends of mRNA. While UTRs play regulatory roles in gene expression, helping control processes like mRNA stability and localisation, they are not directly involved in the translation of proteins. However, UTRs are crucial for the efficient translation process, contributing to the regulation of protein synthesis and influencing the interactions between mRNA and ribosomes. In summary, UTRs on mRNA are essential for the fine-tuning of gene expression, but their primary role is not in the direct translation of proteins. 8. In the presence of allolactose, the lac repressor in the operon of E.coli [Term-I 2021] (A) binds to the operator (B) binds to the promoter (C) cannot bind to the operator (D) binds to the regulator VI. required for efficient translation process. (A) I only (B) II and V (C) III and VI (D) IV and VI K [APQ 2023 – 24] Ans. Option (B) is correct. Explanation: The concept that "a codon is a triplet of bases" was a significant breakthrough in deciphering the genetic code. This insight, crucial to understanding how DNA information is translated into proteins, was independently contributed to by BIOLOGY, Class-XII [B] Assertion & Reason Directions : In the following questions, a statement of assertion (A) is followed by a statement of reason (R). Mark the correct choice as : (A) Both assertion (A) and reason (R) are true and reason (R) is the correct explanation of assertion (A). (B) Both assertion (A) and reason (R) are true but reason (R) is not the correct explanation of assertion (A). (C) Assertion (A) is true but reason (R) is false. (D) Assertion (A) is false but reason (R) is true. 1. Assertion: In the process of transcription, template strand with polarity 3¢ ® 5¢ plays a major role. Reason: DNA dependent RNA polymerase catalyses the polymerisation in only one direction, that is 5¢ ® 3¢. K [APQ 2023 – 24] Ans. Option (A) is correct. Explanation: the template strand guides transcription in the 3¢ ® 5¢ direction, while RNA synthesis occurs in the 5¢ ® 3¢ direction, aligning with the process of transcription. 2. Assertion (A) : Primary transcripts in eukaryotes are non-functional. Reason (R) : Methyl guanosine triphosphate is attached to 5’ – end of hnRNA. U [SQP 2020-21] Ans. Option (B) is correct. This Question is for practice and its solution is given at the end of the chapter. Ans: Option (D) is correct. Explanation: Meselson and Stahl performed the experiments on the DNA and proved that DNA is semi-conservation or disruptive type. The experiment used the radioactively labelled N14. This labelled nitrogen atom helps to detect and analyses the replication pattern. The new strand is formed by using one of the old strands as a template. Explanation: Primary transcripts contains both introns and exon, in which introns are non- coding parts. At 5' end of hnRNA, a cap is formed by modification of GTP into 7-methyl guanosine in the process called capping. 3. Assertion (A): In Griffith’s experiment, the dead R strain bacteria was capable of causing the transformation of the live S-strain bacteria. Reason (R): The S-strain is non-virulent strain. [OEB] K 4. Assertion (A): Ribosomal RNA is synthesised in the nucleus of the cell. Reason (R): It is translated with the enzyme RNA polymerase III. [SQP 2023 – 24] Ans. Option (C) is correct. Explanation: Nucleolus is the site of synthesis of rRNA and synthesis of ribosomes. It is therefore called as ribosomal factory. RNA polymerase I is an enzyme that transcribes ribosomal RNA. 5. Assertion (A): Genetic codes are commaless. Reason (R): Genetic codes are overlapping. [SQP 2023–24] U Ans. Option (C) is correct. Explanation : A commaless genetic code means that no punctuations are needed between any two words. The genetic code is non-overlapping. In actual practice six bases code for not more than two amino acids. 6. Assertion (A): The nucleosome is a repeating unit of a structure in nucleus called chromatin. Reason (R): The negatively charged DNA is wrapped around the positively charged histone octamer to form a structure called nucleosome. [SQP 2023 – 24] U Ans. Option (B) is correct. Explanation: The length of DNA in a human diploid cell is around 2.2 metres. It is greater than the dimension of a typical nucleus. In order to fit them in the nucleus, DNA is wrapped around histone octamer to form a nucleosome. The nucleosome in chromatin gives a ‘beads’ on string appearance. 7. Assertion (A): RNA polymerases are able to catalyse all three steps of translation. Reason (R): RNA polymerases contain an initiation factor and a termination factor in them. [SQP 2023–24] U Ans. Option (D) is correct. Explanation: DNA-dependent RNA polymerase is the “only enzyme” that has the “capability” to catalyse initiation, elongation, and termination in the process of transcription in prokaryotes. Initiation factor sigma helps in the process of initiation while the termination factor Rho help in the termination of the process. 8. Assertion (A): Teminism is unidirectional flow of information. Reason(R) : Teminism was reported in 1978 by H. Temen and D. Baltimore. [OEB] U scientists such as Har Gobind Khorana. Khorana, along with Marshall Nirenberg and Robert W. Holley, played a key role in identifying that a sequence of three nucleotide bases, known as a codon, corresponds to a specific amino acid in a protein. 15. What is the smallest part of a DNA molecule that can be changed by a point mutation? (A) Oligonucleotide (B) Codon (C) Gene (D) Nucleotide K [SQP 2023–24] Ans. Option (D) is correct. Explanation : Nucleotide: It is the smallest unit of DNA which consists of nucleoside and phosphate groups. It is the monomeric unit of nucleic acids such as DNA and RNA. It can be changed by a point mutation 16. Meselson and Stahl’s experiment proved: [SQP 2023–24] (A) Transduction. (B) Transformation. (C) DNA is the genetic material. (D) Disruptive DNA replication. Molecular Basis of Inheritance Ans. Option (D) is correct. Explanation: Teminism is a theoretical concept. In 1978, H.Temin and Baltimore independently discovered Teminism. It is an exception to central dogma of molecular biology. Teminism theory explains that RNA can act as template for the DNA formation, that is, DNA can be synthesised from RNA. As teminism is bidirectional flow of information, it is popularly known as reverse transcription. COMPETENCY BASED QUESTIONS (1 mark each) (C) Both (i) and (ii) are correct [C] Case Based MCQs I. Read the following passage and answer any four questions given below: The lac operon consists of a regulation gene and three structural gene. The lactose acts as inducer. In the presence of an Inducer such as lactose, the repressor is in inactivated during the interaction. This allows RNA polymerase access to the promoter and transcription proceeds. The repressor is synthesized which in turn binds with the operator region of the operon and prevents RNA polymerase from transcribing the operon. [OEB] A 1. When the process of Lac operon is blocked by a repressor, it represents : (A) positive regulation (B) negative regulation (C) sometimes positive sometimes negative (D) both positive and negative regulation Ans. Option (B) is correct. Explanation: The lac operon regulation can be in both negative and positive ways. It is a negative control system because expression is typically blocked by an active repressor (the lac repressor) that turns off transcription. And when CAP (catabolite gene activating protein) binds upstream of this operator region near the promoter and transcription increases, this is an example of a positive system. 2. Identify the correct sequence of the structural genes in the lac operon. (A) lacA-lacZ-lacY (B) lacZ-lacA-lacY (C) lacZ-lacY-lacA (D) lacA-lacY-lacZ Ans. Option (C) is correct. Explanation: The lac operon consists of 3 structural genes, and a promoter, a terminator, regulator, and an operator. The three structural genes are: lacZ, lacY, and lacA. 3. Which of the following statement is true in reference to the lac operon process in E.coli? (i) Galactosidase is the only enzyme produced in large quantities when lac operon is turned on (ii) The messenger RNA in lac operon is a polycistronic mRNA (A) Only (i) is correct (B) Only (ii) is correct (D) None of them are correct Ans. Option (B) is correct. Explanation : The messenger RNA produced by transcription carries information for the synthesis of all three proteins found in all three structural genes. Hence, it is a polycistronic messenger RNA. 4. What provides binding site to RNA polymerase? (A) Exons (B) Promoter (C) Inducer (D) Repressor Ans. Option (B) is correct. Explanation : Promoter helps in starting the process of transcription and provides a binding site to RNA polymerase. 5. The lac operon of E. coli contains genes involved in lactose metabolism. It's expressed only when lactose is____________(1) and glucose is _________(2). (A) 1: Present, 2: Absent (B) 1: Absent, 2: Present (C) 1: More, 2: Less (D) 1: Repressed, 2: Promoted Ans. Option (A) is correct. Explanation: The lac operon of E. coli contains genes involved in lactose metabolism. It's expressed only when lactose is present and glucose is absent. [D] Case Based Subjective Questions I. Look at the lac operon in a bacterium BIOLOGY, Class-XII Predict how these mutations would affect the function of the operon in the presence and absence of lactose(inducer): Refer fig. 5.14 U [CFPQ] 1. Mutation of the regulatory gene (i); mutated repressor won’t bind to lactose but will bind to the operator. 1 mark Ans: The mutated repressor binds to the operator on the DNA, and would continuously repress the operon; enzymes for lactose utilisation would not be made, whether or not lactose was present. 2. Mutation of the operator (o); repressor will not bind to the operator. 1 mark Ans: The lac genes would continue to be transcribed and the enzymes made, whether or not lactose was present 3. Mutation of the promoter (p); RNA polymerase will not attach to the promoter. 2 marks Ans. RNA polymerase would not be able to transcribe the genes and no proteins would be made, whether or not lactose was present. II. Shown below is a nucleotide sequence and the genetic code. 5' - ATGCGTAGACTCGTA - 3' [APQ 2023 – 24] 1. Identify the protein sequence formed by this sequence. 1 mark Ans. TYR ALA SER GLU HIS 2. The first guanine base in the nucleotide sequence changes to cytosine. Identify the type of mutation caused by this change. 1 mark Ans: point mutation 3. Will the mutated sequence form an mRNA and protein? Justify. 2 marks Ans: - mRNA will be formed - protein will not be formed - The first codon is a stop codon due to which translation will not happen SOLUTIONS FOR PRACTICE QUESTIONS (TOPIC-1) VSATQ Ans. 2. Methionine / Tryptophan 1 [Marking Scheme, 2018] LATQ Ans. 6. Prokaryotes: Negatively charged DNA is held with positively charged proteins in nucleoid, DNA in nucleoid is organised in large loops held by protein. ½×4=2 Eukaryotes: In nucleus, the negatively charged DNA is wrapped around positively charged histone octamer to form nucleosome, nucleosomes are repeated to constitute chromatin at higher level, additional set of non-histone chromosomal protein gets associated with chromatin. ½ × 6 = 3 [Marking Scheme, 2016] SOLUTIONS FOR PRACTICE QUESTIONS (TOPIC-2) VSATQ Ans. 2: Genetic mapping & DNA-finger printing. 1 [Marking Scheme, 2016] Ans. 4: The DNA site at which RNA polymerase binds, is called promoter. 1 SATQ-II Ans. 2: (a) Amino acid Ans. 2: (a) Genetic code is said to be degenerate when two or more codons specify a particular amino acid. (b)Genetic code is said to be universal when its coded information specifies the same amino acid across different species. 1+1 SATQ-I Phe Val DNA code in gene AAA CAC Codon in mRNA (i) UUU (ii) GUG Anticodon in tRNA (iii) AAA (iv) CAC 1 (b) (i) A polypeptide containing 14 different amino acid = 14 × 3 = 42 base pairs. 1 (ii) 14 different types of RNA are needed for the synthesis of polypeptide. 1 Molecular Basis of Inheritance It has paved the way for personalised medicine in future based on one’s own genome. It has shed a lot of light on human evolution and phylogenetics. LATQ Goals of HGP To identify all the estimated genes in human DNA To determine the sequences of the 3 billion chemical base pairs that makes up human DNA. To store this information in databases. To improve tools for data analysis. To transfer related technologies to other sectors. To address the ethical, legal and social issues (ELSI) that may arise from the project. (b) Advantages of the Human Genome Project are: It has led to a better understanding of human biology and genetics in general. ¾ (a) ¾ ¾ ¾ ¾ ¾ Ans. 2: (c) BAC stands for Bacterial artificial chromosome. It is an artificially constructed vector containing the origin of replication and a selectable marker for identification. It is capable of carrying large DNA fragments and can replicate easily inside a bacterial cell. It is used in the human genome project for cloning large chunks of the fragmented human genome with ease.2+2+1 SOLUTIONS FOR PRACTICE QUESTIONS (MCQ) Explanation: UUU code for Phenylalanine(phe). UAA and UGA are stop codon while, AUG codes for the Methionine(met) . MCQS Ans. 2. Option (C) is correct. Explanation: Histones are rich in the basic amino residues lysine and arginines. Both of these amino acid residues carry positive charges in their side chains Ans. 3. Option (C) is correct. Explanation: 2''OH group present in RNA(in every nucleotide) makes it more reactive than DNA. Ans. 13. Option (D) is correct. A&R Ans. 3. Option (D) is correct. Explanation: In Griffith's experiment, some 'transforming principle', transferred from heat -killed S strain had enabled the R strain to synthesis a smooth polysaccharide coat. Due to the transfer of the genetic material, the R-strain became virulent. REFLECTION 1. 2. According to Chargaff's rule, Purines and Pyrimidines are always in equal amounts i.e., A + G = T + C. Suppose, if a double stranded DNA has 20 percent cytosine, were you able to calculate the percent of Adenine in DNA. As you have studied in this chapter that insertion or deletion of one or two bases is termed as Point mutation, so, can you recall the term given to the insertion or deletion of the nucleotide due to which there is shifting of the reading frame? Dear Teachers and Students, Join School of Educators' exclusive WhatsApp, Telegram, and Signal groups for FREE access to a vast range of educational resources designed to help you achieve 100/100 in exams! Separate groups for teachers and students are available, packed with valuable content to boost your performance. Additionally, benefit from expert tips, practical advice, and study hacks designed to enhance performance in both CBSE exams and competitive entrance tests. Don’t miss out—join today and take the first step toward academic excellence! Join the Teachers and Students Group by Clicking the Link Below JOIN OUR WHATSAPP GROUPS FOR FREE EDUCATIONAL RESOURCES JOIN SCHOOL OF EDUCATORS WHATSAPP GROUPS FOR FREE EDUCATIONAL RESOURCES We are thrilled to introduce the School of Educators WhatsApp Group, a platform designed exclusively for educators to enhance your teaching & Learning experience and learning outcomes. Here are some of the key benefits you can expect from joining our group: BENEFITS OF SOE WHATSAPP GROUPS Abundance of Content: Members gain access to an extensive repository of educational materials tailored to their class level. This includes various formats such as PDFs, Word files, PowerPoint presentations, lesson plans, worksheets, practical tips, viva questions, reference books, smart content, curriculum details, syllabus, marking schemes, exam patterns, and blueprints. This rich assortment of resources enhances teaching and learning experiences. Immediate Doubt Resolution: The group facilitates quick clarification of doubts. Members can seek assistance by sending messages, and experts promptly respond to queries. This real-time interaction fosters a supportive learning environment where educators and students can exchange knowledge and address concerns effectively. Access to Previous Years' Question Papers and Topper Answers: The group provides access to previous years' question papers (PYQ) and exemplary answer scripts of toppers. This resource is invaluable for exam preparation, allowing individuals to familiarize themselves with the exam format, gain insights into scoring techniques, and enhance their performance in assessments. Free and Unlimited Resources: Members enjoy the benefit of accessing an array of educational resources without any cost restrictions. Whether its study materials, teaching aids, or assessment tools, the group offers an abundance of resources tailored to individual needs. This accessibility ensures that educators and students have ample support in their academic endeavors without financial constraints. Instant Access to Educational Content: SOE WhatsApp groups are a platform where teachers can access a wide range of educational content instantly. This includes study materials, notes, sample papers, reference materials, and relevant links shared by group members and moderators. Timely Updates and Reminders: SOE WhatsApp groups serve as a source of timely updates and reminders about important dates, exam schedules, syllabus changes, and academic events. Teachers can stay informed and well-prepared for upcoming assessments and activities. Interactive Learning Environment: Teachers can engage in discussions, ask questions, and seek clarifications within the group, creating an interactive learning environment. This fosters collaboration, peer learning, and knowledge sharing among group members, enhancing understanding and retention of concepts. Access to Expert Guidance: SOE WhatsApp groups are moderated by subject matter experts, teachers, or experienced educators can benefit from their guidance, expertise, and insights on various academic topics, exam strategies, and study techniques. Join the School of Educators WhatsApp Group today and unlock a world of resources, support, and collaboration to take your teaching to new heights. To join, simply click on the group links provided below or send a message to +91-95208-77777 expressing your interest. Together, let's empower ourselves & Our Students and inspire the next generation of learners. Best Regards, Team School of Educators Join School of Educators WhatsApp Groups You will get Pre- Board Papers PDF, Word file, PPT, Lesson Plan, Worksheet, practical tips and Viva questions, reference books, smart content, curriculum, syllabus, marking scheme, toppers answer scripts, revised exam pattern, revised syllabus, Blue Print etc. here . Join Your Subject / Class WhatsApp Group. Kindergarten to Class XII (For Teachers Only) Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 (Commerce) Class 11 (Science) Class 11 (Humanities) Class 12 (Science) Class 12 (Humanities) Class 12 (Commerce) Kindergarten Subject Wise Secondary and Senior Secondary Groups (IX & X For Teachers Only) Secondary Groups (IX & X) SST Mathematics Science English Hindi-A IT Code-402 Hindi-B Artificial Intelligence Senior Secondary Groups (XI & XII For Teachers Only) Physics Chemistry English Mathematics Biology Accountancy Economics BST History Geography Sociology Hindi Core Home Science Psychology Political Science Painting Vocal Music Comp. Science IP Physical Education APP. Mathematics Legal Studies Entrepreneurship French Hindi Elective Sanskrit IT Artificial Intelligence Other Important Groups (For Teachers & Principal’s) Principal’s Group Teachers Jobs IIT/NEET Join School of Educators WhatsApp Groups You will get Pre- Board Papers PDF, Word file, PPT, Lesson Plan, Worksheet, practical tips and Viva questions, reference books, smart content, curriculum, syllabus, marking scheme, toppers answer scripts, revised exam pattern, revised syllabus, Blue Print etc. here . Join Your Subject / Class WhatsApp Group. Kindergarten to Class XII (For Students Only) Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 (Commerce) Class 11 (Science) Class 11 (Humanities) Class 12 (Science) Class 12 (Humanities) Class 12 (Commerce) Artificial Intelligence (VI TO VIII) Subject Wise Secondary and Senior Secondary Groups (IX & X For Students Only) Secondary Groups (IX & X) SST Mathematics Science English Hindi IT Code Artificial Intelligence Senior Secondary Groups (XI & XII For Students Only) Physics Chemistry English Mathematics Biology Accountancy Economics BST History Geography Sociology Hindi Core Home Science Psychology Political Science Painting Music Comp. Science IP Physical Education APP. Mathematics Legal Studies Entrepreneurship AI French IIT/NEET Hindi Elective Sanskrit IT CUET Groups Rules & Regulations: To maximize the benefits of these WhatsApp groups, follow these guidelines: 1. Share your valuable resources with the group. 2. Help your fellow educators by answering their queries. 3. Watch and engage with shared videos in the group. 4. Distribute WhatsApp group resources among your students. 5. Encourage your colleagues to join these groups. Additional notes: 1. Avoid posting messages between 9 PM and 7 AM. 2. After sharing resources with students, consider deleting outdated data if necessary. 3. It's a NO Nuisance groups, single nuisance and you will be removed. No introductions. No greetings or wish messages. No personal chats or messages. No spam. Or voice calls Share and seek learning resources only. Please only share and request learning resources. For assistance, contact the helpline via WhatsApp: +91-95208-77777. Join Premium WhatsApp Groups Ultimate Educational Resources!! Join our premium groups and just Rs. 1000 and gain access to all our exclusive materials for the entire academic year. Whether you're a student in Class IX, X, XI, or XII, or a teacher for these grades, Artham Resources provides the ultimate tools to enhance learning. Pay now to delve into a world of premium educational content! Click here for more details Class 9 Class 10 Class 11 Class 12 📣 Don't Miss Out! Elevate your academic journey with top-notch study materials and secure your path to top scores! Revolutionize your study routine and reach your academic goals with our comprehensive resources. Join now and set yourself up for success! 📚🌟 Best Wishes, Team School of Educators & Artham Resources SKILL MODULES BEING OFFERED IN MIDDLE SCHOOL Artificial Intelligence Beauty & Wellness Design Thinking & Innovation Financial Literacy Handicrafts Information Technology Marketing/Commercial Application Mass Media - Being Media Literate Travel & Tourism Coding Data Science (Class VIII only) Augmented Reality / Virtual Reality Life Cycle of Medicine & Vaccine Things you should know about keeping Medicines at home What to do when Doctor is not around Blue Pottery Pottery Block Printing Digital Citizenship Humanity & Covid-19 Food Food Preservation Baking Herbal Heritage Khadi Mask Making Mass Media Making of a Graphic Novel Kashmiri Embroidery Embroidery Rockets Satellites Application of Satellites Photography SKILL SUBJECTS AT SECONDARY LEVEL (CLASSES IX – X) Retail Information Technology Security Introduction To Financial Markets Introduction To Tourism Beauty & Wellness Food Production Front Office Operations Banking & Insurance Health Care Apparel Artificial Intelligence Physical Activity Trainer Foundation Skills For Sciences (Pharmaceutical & Biotechnology)(NEW) Automotive Agriculture Marketing & Sales Multi Media Multi Skill Foundation Course Data Science Electronics & Hardware (NEW) Design Thinking & Innovation (NEW) SKILL SUBJECTS AT SR. SEC. LEVEL (CLASSES XI – XII) InformationTechnology Web Application Automotive Financial Markets Management Tourism Beauty & Wellness Agriculture Food Production Front Office Operations Banking Marketing Retail Health Care Insurance Horticulture Typography & Comp. Application Geospatial Technology Electrical Technology Electronic Technology Multi-Media Cost Accounting Office Procedures & Practices Shorthand (English) Air-Conditioning & Refrigeration Medical Diagnostics Textile Design Salesmanship Business Administration Food Nutrition & Dietetics Mass Media Studies Library & Information Science Fashion Studies Applied Mathematics Yoga Early Childhood Care & Education Artificial Intelligence Data Science Physical Activity Trainer(new) Land Transportation Associate (NEW) Electronics & Hardware (NEW) Design Thinking & Innovation (NEW) Taxation Shorthand (Hindi) Design Join School of Educators Signal Groups You will get Pre- Board Papers PDF, Word file, PPT, Lesson Plan, Worksheet, practical tips and Viva questions, reference books, smart content, curriculum, syllabus, marking scheme, toppers answer scripts, revised exam pattern, revised syllabus, Blue Print etc. here . Join Your Subject / Class signal Group. Kindergarten to Class XII Class 1 Class 4 Class 7 Class 2 Class 3 Class 5 Class 6 Class 8 Class 9 Class 10 Class 11 (Science) Class 11 (Humanities) Class 11 (Commerce) Class 12 (Science) Class 12 (Humanities) Class 12 (Commerce) Kindergarten Artifical intelligence Subject Wise Secondary and Senior Secondary Groups IX & X Secondary Groups (IX & X) SST Mathematics English Hindi-A IT Code-402 Science Hindi-B Artifical intelligence IT Senior Secondary Groups XI & XII English Physics Chemistry Mathematics Biology Accountancy BST History Economics Geography Sociology Hindi Elective Hindi Core Home Science Sanskrit Psychology Political Science Painting Vocal Music Comp. Science Physical Education APP. Mathematics Entrepreneurship French Artifical intelligence IP Legal Studies IIT/NEET CUET Join School of Educators CBSE Telegram Groups Kindergarten All classes Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 (Sci) Class 11 (Hum) Class 12 (Sci) Class 11 (Com) Class 12 (Com) CUET Teachers Professional Group Class 12 (Hum) JEE/NEET NDA, OLYMPIAD, NTSE Principal Professional Group Project File Group Join School of Educators ICSE Telegram Groups Kindergarten Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 Class 8 Class 9 Class 10 Class 11 (Sci) Class 11 (Hum) Class 12 (Sci) Class 11 (Com) Class 12 (Com) Class 12 (Hum) Join India’s largest Educator’s Community. Click to join B-TAG WhatsApp Subject Groups
0
You can add this document to your study collection(s)
Sign in Available only to authorized usersYou can add this document to your saved list
Sign in Available only to authorized users(For complaints, use another form )