Biochemical Pharmacology 226 (2024) 116338
Contents lists available at ScienceDirect
Biochemical Pharmacology
journal homepage: www.elsevier.com/locate/biochempharm
ITFG2, an immune-modulatory protein, targets ATP 5b to maintain
mitochondrial function in myocardial infarction
Fang-fang Bi b, 1, Miao Cao b, 1, Qing-ming Pan b, Ze-hong Jing b, Li-fang Lv b, Fu Liu a, Hua Tian a,
Tong Yu c, Tian-yu Li b, Xue-lian Li b, Hai-hai Liang b, Hong-li Shan c, *, Yu-hong Zhou a, b, *
a
Department of Basic Medicine, Xiamen Medical College, Xiamen, Fujian 361023, PR China
Department of Pharmacology (State-Province Key Laboratories of Biomedicine-Pharmaceutics of China, Key Laboratory of Cardiovascular Research, Ministry of
Education), College of Pharmacy, Harbin Medical University, Harbin, Heilongjiang 150081, PR China
c
Shanghai Frontiers Science Research Center for Druggability of Cardiovascular noncoding RNA, Institute for Frontier Medical Technology, Shanghai University of
Engineering Science, Shanghai 201620, PR China
b
A R T I C L E I N F O
A B S T R A C T
Keywords:
ITFG2
ATP synthase subunit-β (ATP 5b)
Mitochondrial function
Myocardial infarction
Ubiquitination
NEDD4-2
ITFG2, as an immune-modulatory intracellular protein that modulate the fate of B cells and negatively regulates
mTORC1 signaling. ITFG2 is highly expressed in the heart, but its pathophysiological function in heart disease is
unclear. In this study, we found that in MI mice, overexpression of ITFG2 via an AAV9 vector significantly
reduced the infarct size and ameliorated cardiac function. Knockdown of endogenous ITFG2 by shRNA partially
aggravated ischemia-induced cardiac dysfunction. In cardiac-specific ITFG2 transgenic (TG) mice, myocardial
infarction size was smaller, eject fraction (EF) and fractional shortening (FS) was higher compared to those in
wild-type (WT) mice, suggesting ITFG2 reversed cardiac dysfunction induced by MI. In hypoxic neonatal car­
diomyocytes (NMCMs), overexpression of ITFG2 maintained mitochondrial function by increasing intracellular
ATP production, reducing ROS levels, and preserving the mitochondrial membrane potential (MMP). Over­
expression of ITFG2 reversed the mitochondrial respiratory dysfunction in NMCMs induced by hypoxia.
Knockdown of endogenous ITFG2 by siRNA did the opposite. Mechanism, ITFG2 formed a complex with NEDD42 and ATP 5b and inhibited the binding of NEDD4-2 with ATP 5b leading to the reduction ubiquitination of ATP
5b. Our findings reveal a previously unknown ability of ITFG2 to protect the heart against ischemic injury by
interacting with ATP 5b and thereby regulating mitochondrial function. ITFG2 has promise as a novel strategy
for the clinical management of MI.
1. Introduction
Mitochondria are key participants and regulators in ATP production
via mitochondrial respiratory metabolism and the process of oxidative
phosphorylation (OXPHOS) [1,2]. Myocardial infarction (MI) can
induce lack of oxygen and nutrients, leading to energy reduction.
Reduced amounts of oxygen available during MI inhibit oxidative
phosphorylation, resulting in the depolarization of mitochondrial
membrane, ATP depletion, and cardiac contractile dysfunction [3,4].
The mitochondrial structural integrity is important to maintain car­
diomyocyte function and to produce ATP. Therefore, maintaining
mitochondrial function is an important therapeutic strategy for pre­
venting cardiac injury during infarction.
Integrin-a FG-GAP repeat-containing protein (ITFG) is an
Abbreviations: AAR, area at risk; AAV9, adeno-associated virus serotype 9 vectors; ATP 5b, ATP synthase subunit-β; [Ca2+]i, resting intracellular Ca2+ concen­
tration; CO2, carbon dioxide; Co-IP, Co-immunoprecipitation; COVID, Coronavirus disease; DCF, dichlorofluorescein; DCFH-DA, 2′,7′-dichlorofluorescein-diacetate;
EF, eject fraction; ETC, electron transport chain; FCCP, carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone; FS, fractional shortening; IS, infarct area; ITFG,
Integrin-a FG-GAP repeat-containing protein; LAD, left anterior descending; LV, left ventricular; MI, myocardial infarction; MMP, mitochondrial membrane potential;
MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; NC, negative control; NMCMs, neonatal mouse cardiomyocytes; O2, oxygen; OCR, oxygen
consumption rate; OXPHOS, oxidative phosphorylation process; PVDF, polyvinylidene difluoride; ROS, reactive oxygen species; SS, Sarcomere shortening; TEM,
Transmission electron microscopy; TTC, 2,3,5-triphenyltetrazolium chloride triazole; WT, wild type; α-MHC, α-myosin heavy chain.
* Corresponding authors.
E-mail addresses: shanhl@sues.edu.cn (H.-l. Shan), zyh2023@xmmc.edu.cn (Y.-h. Zhou).
1
Fang-fang Bi and Miao Cao contributed equally to this work.
https://doi.org/10.1016/j.bcp.2024.116338
Received 21 November 2023; Received in revised form 12 May 2024; Accepted 4 June 2024
Available online 6 June 2024
0006-2952/© 2024 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
F.-f. Bi et al.
Biochemical Pharmacology 226 (2024) 116338
intracellular protein which modulate T cell maturation and plays an
important role in immune system. Two subtypes of ITFG exist, ITFG1
and ITFG2, the first of which was found in high throughput screening of
protein products modulating T cell function. Mouse ITFG2 is a 447-aa
protein whose full-length protein sequence has 89 % homology with
the human genome, while it has a weaker homology with human ITFG1.
A recent study was shown that ITFG2 modulated B cell differentiation
and negatively regulate the autoimmune response in subjects with lupus
[5]. Another report highlighted that the ITFG2 protein is closely related
to glucose deprivation in cultured cells [6], oxygen glucose deprivation
is a common in vitro model to mimic ischemia/hypoxia in car­
diomyocytes and neuronal cells [7,8], and GeneCard database showed
that ITFG2 was highly expressed in the heart. Therefore we hypothe­
sized that ITFG2 may play a role in cardiac disease. However, knowledge
about the role of ITFG2 in mammalian physiology is currently limited. In
particular, the detailed roles and mechanisms of ITFG2 in processes
associated with cardiac diseases such as MI have not been reported.
In this study, we investigated the effect of ITFG2 in MI by performing
loss- and gain-of-function experiments and to elucidate cellular and
molecular mechanisms. This study would provide a basis for developing
novel therapeutic strategies to protect cardiomyocytes during MI.
Hence, ITFG2 replacement has potential as a therapeutic strategy for MI.
2.4. Echocardiography
Cardiac functions of all mice were evaluated 6 h after LAD ligation.
We anesthetized the mice with pentobarbital (50 mg/kg, P3761, SigmaAldrich, USA), and then used echocardiography to record cardiac
function. We used vevo2100 high-resolution ultrasound imaging system
and recorded cardiac function under M-mode recordings. ST-segment
elevation as determined by electrocardiogram (ECG) indicated suc­
cessful occlusion of the artery.
2.5. Measurement of infarct size by tetrazolium chloride staining
2,3,5-triphenyltetrazolium chloride triazole (TTC, G3005, Solarbio,
China) staining was used to evaluate myocardial infarct size. Mice were
euthanized and their hearts were removed rapidly to measure the infarct
size by microscopy after evaluation for cardiac function. After rapid
removal of the heart, the slices were continuously cut into sections with
a thickness of 1–2 mm. The slices were incubated with 2.0 % 2,3,5-tri­
phenyltezolazole chloride at 37 ◦ C for 15 min. Staining was stopped,
and the sections were fixed in 4 % neutral buffered formaldehyde
(BL539A, biosharp, China) for 5 min. The pictures of slices were taken
by the Zeiss microscope (SteREO Discovery. V8, Germany). The infarct
area and total area of the slices were calculated using Image J.
2. Materials and methods
2.6. Transmission electron microscopy (TEM)
2.1. Experimental animals and mouse model of MI
Neonatal mouse cardiomyocytes (NMCMs) were cultured in six-well
plates and transfected with overexpression/knockout ITFG2 plasmid
according to experimental grouping. After 48 h, the cardiomyocytes
were scraped gently with 1 ml PBS (MA0015, meilunbio, China), and the
cell suspensions were collected and placed in 1.5 ml Eppendorf, and
centrifuged at 4 ℃(1500 rpm, 5 min) to remove cell cellular debris/dead
cells. Then precipitate was then re-suspended in 2.5 % glutaraldehyde
(P1126, Solarbio, China). Using Hitachi 7650 transmission electron
microscope to observe at 80 kV, five areas of cell samples were selected
and photographed at 10,000 times field of view.
All experiments about animal were under the approvement of the
Committee for Animal Experimentation of Harbin Medical University
(approval ID: DEC6121) and international guidelines regarding animal
experimentation. A pathogen free and temperature control animal house
was used to feed mice on a 12:12 h light/dark cycle and given free access
to a standard diet and tap water.
The mice were subjected to left anterior descending (LAD) artery
ligation following the reported process [9]. Briefly, the mice were
anesthetized with sodium pentobarbital (50 mg/kg, P3761, SigmaAldrich, USA) by intraperitoneal injection and ventilated with a small
animal ventilator. Thoracotomy was used to open the pericardium of
each mouse and encircle and ligate the LAD by a 7/0 silk suture. In Sham
group, as surgical controls, LAD was encircled without ligation.
2.7. Transfection of ITFG2 siRNA and plasmids
An siRNA targeting ITFG2 (siITFG2) and scrambled sequence RNA,
as negative control (siNC) was purchased form Shanghai Gene Pharma
Co., Ltd. (Shanghai, China). Using X-treme GENE Transfection Reagent
(04476093001, Roche, Switzerland), these siRNAs were transfected into
neonatal mouse myocytes at a final concentration of 100 nmol/L ac­
cording to the manufacturer’s protocols.
2.2. Virus vector construction and infection
We used adeno associated virus serotype 9 vectors (AAV9) to
construct ITFG2 knockdown or ITFG2 overexpression model in vivo. The
vectors containing the interference fragment to ITFG2 (shITFG2) were
used for loss-of-function. The interference sequences were as following:
Forward: AGCTGCCATGAGGTCGGTTAGTTCTCGAGAACTAACCGACCT
CATGGCtttttGTAC; Reverse: aaaaaGCCATGAGGTCGGTTAGTTCTCGA­
GAACTAACCGAC CTCATGGC. The vector containing the full-length
ITFG2 sequence were used for gain-of-function. C57BL/6 mice were
administered, by tail vein, at a dose of 1 × 1011 genome copies/mouse,
with AAV9 carrying an empty vector or shITFG2 vector or ITFG2 vector,
and the following experiment was performed 3w later.
2.8. Culture of neonatal mouse cardiomyocytes (NMCMs) and hypoxia
induction
For acute separation of cardiomyocytes, the hearts of 3-day-old
neonatal mice were quickly taken and the ventricles were cut into
1–2 mm3 pieces, and the myocardial tissue was digested by trypsin
(C0201, Beyotime, China). The cell suspension is collected by centrifu­
gation and the collected cells are re-suspended in the DMEM (C3113,
Vivacell, China) supplemented with 10 % fetal bovine serum, penicillin
(100 U/mL) and streptomycin (100 U/mL) and cultured in a humidified
incubator at 37 ◦ C in 5 % CO2 and 95 % air. After differential wall
attachment to remove fibroblasts, the dissociated cardiomyocytes were
then collected and plated for another 48 h before use for subsequent
experiments. The cultured cardiomyocytes were incubated under hyp­
oxic condition (5 % CO2 and 95 % N2) for 12 h.
2.3. Cardiac-specific transgenic (TG) mice
Cardiac-specific ITFG2 TG and ITFG2 wild-type (WT) mice were
generated from C57Bl/6J mice according to the following procedures.
An expression plasmid carrying full-length ITFG2 TG and ITFG2 WT
cDNA was constructed with α-myosin heavy chain (α-MHC) promoter.
TG mice were generated by oocyte micro-injection [10]. We used po­
lymerase chain reaction (PCR) to verify the genotype of the TG mice and
the primers 5′GTGGTGGTGTAGGAAAGTCAGGAC and 5′GCTTCATC
AGACTCTCTACCATC. Then we verified the sequences of ITFG2 gene
with 284 amplified base-pair fragments.
2.9. Western blot analysis
The protein was extracted by Western blot analysis using RIPA lysis
buffer (P0013B, Beyotime, Shanghai, China) and quantified by BCA
2
F.-f. Bi et al.
Biochemical Pharmacology 226 (2024) 116338
Fig. 1. ITFG2 improves the cardiac function of MI mice. Overexpression of ITFG2 via an AAV9 vector encoding the full-length ITFG2 gene in MI mice. Inhibition of
ITFG2 via an AAV9 vector carrying an shRNA to knock down endogenous ITFG2 in mice. (A) Procedure of the experiment. (B, C) Corresponding EF and FS values of
AAV9-ITFG2 mice. (D) TTC dyeing representative diagram and statistical diagram of AAV9-ITFG2 mice. (E, F) Corresponding EF and FS values of AAV9-shITFG2
mice. (G) TTC dyeing representative diagram and statistical diagram of AAV9-shITFG2 mice. *P < 0.05 vs. the sham group, #P < 0.05 vs. the MI group, n = 5.
The data are presented as the mean ± SEM.
(P0009, Beyotime, Shanghai, China). After SDS-PAGE separation, the
proteins in the gels were transferred onto polyvinylidene difluoride
membranes. Blocking membranes with nonfat milk (BS102, biosharp,
China) and incubating with the appropriate primary antibody at 4 ◦ C
overnight, washing and incubating with a secondary antibody at room
temperature. Membranes were incubated with primary antibodies
overnight at 4 ◦ C, including rabbit anti-ITFG2 antibody (Santa Cruz, CA,
USA, Cat#:sc-271420, 1:1000), rabbit anti-ATP 5b antibody (Pro­
teintech, Wuhan,China Cat#: 17247-1-AP, 1:500), rabbit anti-Total
OXOHOS Rodent WB antibody (ab110413, Abcam, Cambridge Science
Park, UK,1:500), rabbit anti-NEDD4-2 antibody (Proteintech, Wuhan,
China, Cat#: 13690-1-AP, 1:500), Mouse GAPDH antibody (Zhong­
shanjinqiao, Beijing, China, Cat#: TA-09, 1:1000) was used as an in­
ternal reference. The Odyssey v1.2 software was used to detect and
analyze blots (LICOR Biosciences, Lincoln, NE, USA).
protocol. JC-1 exhibited potential-dependent accumulation in the
mitochondria, a fluorescence emission shift from green (525 ± 10 nm)
to red (610 ± 10 nm). Healthy cells have high membrane potential with
red fluorescence emitting from JC-1 forms complexes. JC-1 in a mono­
meric form emit green fluorescence and unhealthy cells have low MMP.
Ratio of red to green fluorescence showed the state of the membrane
potential.
2.11. ATP production
Detection of ATP content in cells by ATP Assay Kit (S0026, Beyotime,
Shanghai, China). Solution of ATP standard was diluted with distilled
water to concentrations (5 total) on ice. Next, 50 μL of the ATP detection
working solution was added to the sample tube for 5 min, followed by
the addition of 10 μmol/L ATP standard solution. The sample was mixed
quickly, and the RLU value was read using a photometer. The ATP
concentration of the sample was received according to the standard
curve.
2.10. Mitochondrial membrane potential (MMP) assessment
We used JC-1 staining (C2006, Beyotime, Shanghai, China) to assess
the MMP in the CMs. In short, cardiomyocytes were incubated with
equal volume of JC-1 staining solution according to the manufacturer’s
3
F.-f. Bi et al.
Biochemical Pharmacology 226 (2024) 116338
Fig. 2. Transgenic overexpression of ITFG2 alleviates MI-induced myocardial injury. (A) Diagram of the ITFG2 overexpression transgenic mouse (TG) construction.
(B) Upregulation of cardiac ITFG2 expression in TG mice. *P < 0.05 vs. the WT, n = 3. (C) Myocardial infarct sizes in each group and quantification of infarct sizes.
#
P < 0.05 vs. the WT + MI group; n = 4. Scale bar, 2 mm. (D) Representative M mode echocardiograms and corresponding EF and FS values of mice (*P < 0.05 vs. the
WT + sham group, #P < 0.05 vs. the WT + MI group; n = 5). (E, F) KEGG pathway enrichment analysis using Mass spectrometry using lysates of immunoprecipitation
with ITFG2 from the mouse hearts. The data are presented as the mean ± SEM.
2.12. Determination of reactive oxygen species (ROS) generation
was placed in each well of a Seahorse XF24 cell culture plate and
incubated overnight at room temperature. The stimulated oxygen con­
sumption rate (OCR, final concentration) was determined using 1.5
μmol/L oligomycin (ATP uncoupler) together with 1 μmol/L 172
carbonyl cyanide-4-(trifluoromethoxy) phenylhydrazone (FCCP) or 0.5
μmol/L rotenone/antimycin A. The OCR values were normalized at the
end.
Using a Reactive Oxygen Species Assay Kit (S0033S, Beyotime,
Shanghai, China) to measure intracellular ROS levels were measured.
We use fluorescent dichlorofluorescein (DCF) to quantify the ROS levels,
because 2′,7′-dichlorofluorescein diacetate (DCFH-DA) is easily oxidized
to DCF by intracellular ROS. Briefly, the cells were added into 24-well
plates treated with DCFH-DA for 25 min at 37 ◦ C, and then the cells
were observed in fluorescence microscopy (Zeiss, Jena, Germany) at
488 nm wavelength.
2.15. Statistical analysis
Two-tailed Student’s t-test was used to compare the differences be­
tween two groups, and one-way ANOVA with post hoc Tukey’s test was
used to compare the differences among multiple groups. P values less
than 0.05 indicated statistical significance. The data are presented as the
mean ± SEM. GraphPad Prism 8.0 were used to do all statistical
analyses.
2.13. Co-immunoprecipitation (Co-IP)
NMCMs were prepared according to experimental grouping, and
NMCMs were lysed in RIPA lysis buffer and then treated with ATP5b
antibody at 4 ◦ C. Lysates of negative control were immunoprecipitated
with IgG antibody (30000–0-AP, Proteintech, China). Immunoprecipi­
tation complexes were collected with protein A/G plus-agarose beads
(HY-K0202, MCE, USA) and washed 10 times with PBST. Protein
immunoprecipitation was used to detect ATP5b ubiquitination level.
3. Results
3.1. ITFG2 improved cardiac dysfunction indued by MI
We have reported that the downregulation of ITFG2 in a mouse MI
model and a hypoxia-induced cell model strongly suggested that ITFG2
plays a crucial role in cardiac function under physiological conditions.
Therefore, we assessed whether the upregulation of ITFG2 could protect
against ischemic cardiac injury by using an AAV9 vector to overexpress
the ITFG2 gene and thereby induce gain of function in vivo (Fig. 1A). As
illustrated (Fig. 1B and C), in MI mice, both the ejection fraction (EF)
and fractional shortening (FS) were significantly decreased compared to
2.14. Assay of XF24 oxygen consumption and the oxygen consumption
rate
XF24 extracellular flux analyzer from Seahorse Bioscienc was used to
measure oxygen consumption. Agilent Seahorse XFe24 was purchased
from Agilent Company, USA. Firstly, cells were plated on an XF24 cell
culture plate at 1 × 105 cells/pore and each sample group has the equal
numbers of cells. On the day before the test, 250 μL of growth medium
4
F.-f. Bi et al.
Biochemical Pharmacology 226 (2024) 116338
Fig. 3. Overexpression of ITFG2 improves mitochondrial function damage induced by hypoxia. (A) Representative electron microscopy images of mitochondrial
morphology and statistical diagram of mitochondrial density. *P < 0.05 vs. the control group, #P < 0.05 vs. the hypoxia group, n = 5. Scale bar, 2 μm. (B)
Representative images of JC-1 staining to detect the mitochondrial membrane potential and the statistical graph of the fluorescence intensity of high (red) and low
(green) mitochondrial membrane potential. Scale bar, 40 μm. (C) ROS production as detected by a DCFH-DA probe. Scale bar, 20 μm. (D) Effect of ITFG2 over­
expression on the ATP production in NMCMs induced by hypoxia. **P < 0.01 vs. the control group, #P < 0.05 vs. the hypoxia group, n = 5. (E) Oxygen consumption
assays of mitochondrial respiration using extracellular flux analysis. The maximum oxygen consumption rate (OCR) was measured in NMCMs cultured under control
and hypoxic conditions for 12 h, followed by treatment with the ITFG2 overexpression or NC vector. *P < 0.05 vs. the control group, #P < 0.05 vs. the hypoxia group,
n = 5. The data are presented as the mean ± SEM. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of
this article.)
the Sham group. ITFG2 overexpression improved cardiac function as
indicated by the higher ejection fraction and fractional shortening
values as well as by the smaller infarct size, but negative control (NC)
had no effect on cardiac function and infarct size (Fig. 1B–D).
Next, we utilized a loss-of-function approach with an AAV9 vector
carrying an ITFG2 shRNA fragment (shITFG2) and observed the dele­
terious effects of ITFG2 knock out on the heart. As predicted (Fig. 1E–G),
shITFG2, but not NC, significantly exacerbated the cardiac dysfunction
induced by MI surgery, as showed by the lower ejection fraction and
fractional shortening values, and increased infarct size.
illustrated by the higher ejection fraction and fractional shortening
values compared with those of the WT mice after MI surgery (Fig. 2C and
D).
Mass spectrometry using lysates of immunoprecipitation with ITFG2
from TG mice hearts and KEGG pathway enrichment analysis suggested
that mitochondrial function was involved in the cardioprotective effect
of ITFG2 (Fig. 2E and F).
3.3. ITFG2-modulated changes in mitochondrial function
Myocardial infarction can damage respiratory metabolism and
OXPHOS process, leading to the depolarization of mitochondrial mem­
brane, the depletion of ATP, and inhibition of cardiac contractile func­
tion. Therefore, we investigated the potential effects of ITFG2 on the
mitochondrial function in hypoxia-treated NMCMs. Electron microscopy
analysis (Fig. 3A) showed that hypoxia could clearly alter the mito­
chondrial morphology, as they exhibited induced swelling, a black
matrix, and loss of cristae compared to the control. Interestingly, these
ultrastructural changes were partially reversed by ITFG2 overexpression
in hypoxia-treated cardiomyocytes. From a functional viewpoint, we
3.2. Transgenic overexpression of ITFG2 alleviates MI-induced
myocardial injury
To further confirm the cardioprotective effects of ITFG2, we gener­
ated cardiac-specific ITFG2 TG mice (Fig. 2A and B). Compared to WT
mice, no detectable structural or functional changes were detected in the
TG mice under Sham condition. However, after MI surgery, the injury
was alleviated in TG mice, which was indicated by the reduced
myocardial infarction sizes and the improved cardiac function, as
5
F.-f. Bi et al.
Biochemical Pharmacology 226 (2024) 116338
Fig. 4. Knockdown of ITFG2 aggravates the mitochondrial function damage induced by hypoxia. (A) Representative electron microscopy images of mitochondrial
morphology and statistical diagram of mitochondrial density. *P < 0.05 vs. the control group, #P < 0.05 vs. the hypoxia group, n = 5. Scale bar, 2 μm. (B)
Representative images of JC-1 staining to detect the mitochondrial membrane potential and the statistical graph of the fluorescence intensity of high (red) and low
(green) mitochondrial membrane potential. Scale bar, 40 μm. (C) ROS production as detected by a DCFH-DA probe. Scale bar, 20 μm. (D) Effect of ITFG2 knockdown
on the ATP production in NMCMs induced by hypoxia. *P < 0.05 vs. the control group, #P < 0.05 vs. the hypoxia group, n = 5. (E) Oxygen consumption assays of
mitochondrial respiration using extracellular flux analysis. The maximum oxygen consumption rate (OCR) was measured in NMCMs cultured under control and
hypoxic conditions for 12 h, followed by treatment with the siITFG2 or siNC vector. *P < 0.05 vs. the control group, #P < 0.05 vs. the hypoxia group, n = 5. The data
are presented as the mean ± SEM. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
believed that the MMP is altered in correlation with such morphological
changes. JC-1 staining (Fig. 3B) showed that hypoxia robustly decreased
the red fluorescence intensity, suggesting MMP loss, and this deleterious
change was partially restored by ITFG2 overexpression. The hypoxiainduced increase in mitochondrial ROS and the decreased ATP level
was reversed by ITFG2 overexpression (Fig. 3C and D).
Next, we assessed the effect of ITFG2 on respiratory capacity of
mitochondrial by measuring OCR, indicating mitochondrial function.
Basal respiration was decreased, and O2 consumption rate during ATP
synthesis (oligomycin-sensitive component of basal respiration) was
decreased in hypoxic NMCMs. ITFG2 overexpression reversed the
reduction in the maximal OCR in hypoxic, as well as basal respiration,
maximal respiration, and ATP production; NC did not have these effects
(Fig. 3E). These results indicated the protective effect of ITFG2 on
mitochondria integrity and function.
To further verify the protective effect of ITFG2 on mitochondria
function, cardiomyocytes were transfected with siITFG2 or NC and were
exposed to hypoxia for 12 h. The pathological alterations of mitochon­
dria morphology mediated by hypoxia were aggravated by siITFG2
treatment (Fig. 4A). Consistently, JC-1 staining showed that knocking
down ITFG2 aggravated the hypoxia-induced decrease in the MMP
(Fig. 4B) and ATP level and exacerbated hypoxia-induced ROS pro­
duction (Fig. 4C). SiITFG2 accelerated the reduction in the maximal
OCR in NMCMs exposed to a hypoxic environment, as well as the basal
respiration, maximal respiration, and ATP production (Fig. 4E). These
results confirmed that silencing ITFG2 aggravated the hypoxia-induced
mitochondrial damage in cardiomyocytes, suggesting a protective effect
of ITFG2.
3.4. ITFG2 interacts with ATP 5b
Immunoprecipitation coupled with mass spectrometry was per­
formed on lysates from the hearts of WT and TG mice. Among the list of
proteins that potentially interact with ITFG2, ATP synthase subunit-β
(ATP 5b) was selected because of their high binding potential (Fig. 5A).
We next examined the protein expression of mitochondrial electron
transport chain (ETC) complexes in WT and TG mice. No differences in
ETC complex II-IV expression were observed between WT and TG mice,
about the expression of the ETC complex I and complex V (ATP syn­
thase) was increased in ITFG2 TG mice (Fig. 5B).
ATP 5b is responsible for ATP synthesis to match the ATP con­
sumption in cardiomyocytes and plays a major role in maintaining
mitochondrial function [11,12]. Moreover, ATP 5b was abnormally
downregulated in cardiac diseases, including MI [12,13]. Therefore, we
next wanted to determine whether ITFG2 is involved in the regulation of
ATP 5b to maintain mitochondrial function.
6
F.-f. Bi et al.
Biochemical Pharmacology 226 (2024) 116338
Fig. 5. ITFG2 regulates the protein level of ATP5b under ischemic condition and inhibited the ubiquitination of ATP5b. (A) The hierarchical clustering heat map. (B)
Representative immunoblot images and the statistical graph corresponding to the cardiac ETC complex subunits of WT and ITFG2 TG mice. *P < 0.05 vs. the WT
group, n = 3. CI, complex I; CII, complex II; CIII, complex III; CIV, complex IV; CV, complex V. siITFG2 was transfected into NMCMs to knock down ITFG2 under
hypoxic conditions. (C) Representative Western blot band showing the levels of ATP5b and its statistical graph. *P < 0.05 vs. the control group, #P < 0.05 vs. the
hypoxia group, n = 4. (D) The mRNA expression level of ATP5b and its statistical diagram. *P < 0.05 vs. the control group, n = 6. (E) Lysates from hypoxic NMCMs
were immunoprecipitated with anti-ATP5b antibody and blotted with anti-ubiquitin. Quantification of the relative ubiquitinated ATP5b level. (F) Protein immu­
noprecipitation images confirmed the physical interaction between ITFG2 and ATP5b, ITFG2 and NEDD4-2 in cardiomyocytes from control mice (G) Left ventricular
lysate of ITFG2-TG or WT mice immunoprecipitated with anti-NEDD4-2 antibody and then immunoblotted ATP5b and NEDD4-2. The blotted protein was quantified.
The data are presented as the mean ± SEM.
To determine the functional significance of the ITFG2 and ATP 5b
interaction in cells, we examined on expression of ATP 5b in NMCMs
with ITFG2 overexpression. NMCMs were transfected with ITFG2 or NC.
In Fig. 5C-D, ATP 5b protein and mRNA expressions were significantly
decreased in response to hypoxia. Overexpression of ITFG2 recovered
the protein expression of ATP 5b but had no effect on its mRNA
expression compared to hypoxia. These results suggested that the
changes of ATP 5b protein expression may be regulated by posttranslational regulation.
Ubiquitination is an important pathway for protein degradation.
Ubiquitin-specific proteases (USPs) also regulate mitochondrial dy­
namics, including ubiquitination and deubiquitination of proteins [14].
Ubiquitination status of ATP 5b was further confirmed by coimmunoprecipitation in hypoxic-treated cardiomyocytes and the re­
sults indicated that ITFG2 overexpression inhibited the enhanced ATP
5b ubiquitination under hypoxic conditions (Fig. 5E). NEDD4-2 is one of
ubiquitin E3 ligases and is cardioprotective against I/R-induced car­
diomyocyte apoptosis. We found endogenous ATP 5b was detected in
lysates pulled down with an anti-ITFG2 antibody by Western blotting
(Fig. 5F). Likewise, endogenous NEDD4-2 was observed in the antiITFG2 pull-down complex, illustrating the interaction ITFG2, NEDD42 and ATP 5b. In WT and TG mice, we found ITFG2 decreased the
binding activity between NEDD4-2 and ATP 5b using Co-IP (Fig. 5G).
This result was consistent with the reduced ubiquitination of ATP5b in
NMCMs induced by ITFG2 overexpression.
4. Discussion
Myocardial infarction induces cardiac dysfunction, and infarct size in
the myocardium is associated with the severity of LV dysfunction and
mortality [15,16]. Reducing the infarct size has been found to improve
cardiac function [15,17,18]. Decreased mortality and improved LV
function were associated with a reduction in infarct size [15,18,19].In
our study, overexpression of ITFG2 significantly decreased the infarct
size by 44 % compared to that in the MI group. We also investigated that
ITFG2 improved the left ventricular systolic and diastolic function in
hearts induced by MI. These results showed that ITFG2 improved the
impaired cardiac function induced by MI and exerted a protective effect
against infarction injury.
MI injury is well known to be involved in mitochondrial dysfunction
and cell death via both apoptosis and necrosis [20]. Mitochondria are
vulnerable to damage by ROS generated by the electron respiratory
chain and excess Ca2+ release. The occurrence of Ca2+ overload, ATP
depletion, and necrotic cell death during ischemia promote the opening
of the mitochondrial permeability transition pore (mPTP), leading to the
swelling and rupture of mitochondria [21]. Our study showed that an
improvement in mitochondrial function in terms of mitochondrial
structure, membrane potential, ROS generation, and ATP production.
These results suggest that the protective effect of ITFG2 on the heart is
involved in the maintenance of mitochondrial function.
Mitochondrial ATP synthase is an important component in mito­
chondrial respiratory chain that is responsible for ATP production to
7
F.-f. Bi et al.
Biochemical Pharmacology 226 (2024) 116338
match the ATP consumption in cardiomyocytes [22,23]. ATP synthase
dysfunction is frequently associated with metabolic defects, such as the
impairment of OXPHOS and activation of mitochondrial dependent
apoptosis, such as triggering the release of cytochrome C and ROS.
Therefore, reversing ATP synthase dysfunction will increase the mito­
chondrial energy supply and improve cardiac function to protect heart
against ischemic injury. Intermittent hypobaric hypoxia (IHH) signifi­
cantly alleviated the reduction in ATP content and improved the mito­
chondrial ATP synthase activity after MI [24]. S100A1, a Ca2+-sensing
protein of the EF-hand family, plays an important protective role in MI
and heart failure by increasing ATP synthase activity and promoting
cardiac energy metabolism [25]. Consistent with these studies, we
verified that the both the expression and activity of ATP synthase were
decreased in hypoxic NMCMs, resulting in ATP production being
reduced and mitochondrial function being disturbed. Overexpression of
ITFG2 reversed the activity of ATP synthase to nearly normal levels.
Moreover, ITFG2 increased mitochondrial ATP production and
improved mitochondrial respiratory function.
ATP 5b is the catalytic subunit of ATP synthase, which plays an
important role in ATP synthesis and plays a major role in maintaining
mitochondrial function. The expression of ATP 5b is decreased during
MI or heart failure [12,13]. The expression of ATP 5b is decreased
significantly at 1, 2 and 3 time points, which may serve as a biomarker in
AMI [26]. Our study found that the interaction between ITFG2 and ATP
5b was one of mechanisms underlying the improvement in ATP synthase
activity. We herein provide the first evidence of ITFG2 protecting
against cardiac damage by intracellular mechanism, thereby preserving
mitochondrial function. In our study, ITFG2, as an immune-modulated
protein and a component of mTOR modulator KICSTOR, has been
found to be a novel therapeutic target for MI injury. Undoubtedly, a
more detailed understanding of the molecular interactions between ATP
synthase and ITFG2, as well as other mitochondrial target proteins
identified by pull-down experiments, is needed to better understand the
molecular mechanisms underlying the involvement of ITFG2 in cardiac
energy metabolism.
In addition, the present study has some shortcomings. It has been
reported that genetic changes 6 h after cardiac ischemic injury are
mainly enriched in redox processes [27]. The present study only re­
ported that ITFG2 affects mitochondrial function at 6 h of ischemia
thereby ameliorating cellular injury. Cardiac remodeling occurs days to
weeks after myocardial infarction injury, and it would be useful to
determine the effects of ITGF2 on myocardial fibrosis or infiltration of
macrophages, T cells, and neutrophils into the myocardium.
In summary, we revealed that ITFG2 exerts a protective effect on
myocardial infarction mainly by maintaining mitochondrial function in
vivo and in vitro, and may be a potential therapeutic target for
myocardial infarction. Therefore, ITFG2 replacement therapy may be a
new approach for the clinical treatment of myocardial infarction.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
Data availability
Data will be made available on request.
Acknowledgements
This project was supported by science and technology project of
Xiamen Medical College (K2023-08) and the National Natural Science
Foundation of China (81872863, 82003757).
References
[1] H.L. Lee, C.L. Chen, S.T. Yeh, J.L. Zweier, Y.R. Chen, Biphasic modulation of the
mitochondrial electron transport chain in myocardial ischemia and reperfusion,
Am. J. Phys. Heart Circ. Phys. 302 (7) (2012) H1410–H1422.
[2] Q. Chen, S. Moghaddas, C.L. Hoppel, E.J. Lesnefsky, Reversible blockade of
electron transport during ischemia protects mitochondria and decreases
myocardial injury following reperfusion, J. Pharmacol. Exp. Ther. 319 (3) (2006)
1405–1412.
[3] L.L. Ma, Z.W. Ding, P.P. Yin, J. Wu, K. Hu, A.J. Sun, Y.Z. Zou, J.B. Ge, Hypertrophic
preconditioning cardioprotection after myocardial ischaemia/reperfusion injury
involves ALDH2-dependent metabolism modulation, Redox Biol. 43 (2021)
101960.
[4] M.J. Jou, T.I. Peng, R.J. Reiter, Protective stabilization of mitochondrial
permeability transition and mitochondrial oxidation during mitochondrial Ca(2+)
stress by melatonin’s cascade metabolites C3-OHM and AFMK in RBA1 astrocytes,
J. Pineal Res. 66 (1) (2019) e12538.
[5] A. Al-Shami, J. Crisostomo, C. Wilkins, N. Xu, J. Humphries, W.C. Chang, S.
J. Anderson, T. Oravecz, Integrin-alpha FG-GAP repeat-containing protein 2 is
critical for normal B cell differentiation and controls disease development in a
lupus model, J. Immunol. 191 (7) (2013) 3789–3798.
[6] R.L. Wolfson, L. Chantranupong, G.A. Wyant, X. Gu, J.M. Orozco, K. Shen, K.
J. Condon, S. Petri, J. Kedir, S.M. Scaria, M. Abu-Remaileh, W.N. Frankel, D.
M. Sabatini, KICSTOR recruits GATOR1 to the lysosome and is necessary for
nutrients to regulate mTORC1, Nature 543 (7645) (2017) 438–442.
[7] H. Cheng, M. Sun, Z.L. Wang, Q. Wu, J. Yao, G. Ren, X.L. Sun, LncRNA RMSTmediated miR-107 transcription promotes OGD-induced neuronal apoptosis via
interacting with hnRNPK, Neurochem. Int. 133 (2020) 104644.
[8] H. Wang, J. Hua, S. Chen, Y. Chen, SERPINB1 overexpression protects myocardial
damage induced by acute myocardial infarction through AMPK/mTOR pathway,
BMC Cardiovasc. Disord. 22 (1) (2022) 107.
[9] Y. Zhang, L. Jiao, L. Sun, Y. Li, Y. Gao, C. Xu, Y. Shao, M. Li, C. Li, Y. Lu, Z. Pan,
L. Xuan, Y. Zhang, Q. Li, R. Yang, Y. Zhuang, Y. Zhang, B. Yang, LncRNA ZFAS1 as
a SERCA2a inhibitor to cause intracellular Ca(2+) overload and contractile
dysfunction in a mouse model of myocardial infarction, Circ. Res. 122 (10) (2018)
1354–1368.
[10] Y. Zhang, X. Zhang, B. Cai, Y. Li, Y. Jiang, X. Fu, Y. Zhao, H. Gao, Y. Yang, J. Yang,
S. Li, H. Wu, X. Jin, G. Xue, J. Yang, W. Ma, Q. Han, T. Tian, Y. Li, B. Yang, Y. Lu,
Z. Pan, The long noncoding RNA lncCIRBIL disrupts the nuclear translocation of
Bclaf1 alleviating cardiac ischemia-reperfusion injury, Nat. Commun. 12 (1)
(2021) 522.
[11] Y. Ito, M. Ikeguchi, Mechanism of the αβ conformational change in F1-ATPase after
ATP hydrolysis: free-energy simulations, Biophys. J. 108 (1) (2015) 85–97.
[12] C. Xu, X. Zhang, C. Yu, G. Lu, S. Chen, L. Xu, W. Ding, Q. Shi, Y. Li, Proteomic
analysis of hepatic ischemia/reperfusion injury and ischemic preconditioning in
mice revealed the protective role of ATP5beta, Proteomics 9 (2) (2009) 409–419.
[13] F. Bosetti, G. Yu, R. Zucchi, S. Ronca-Testoni, G. Solaini, Myocardial ischemic
preconditioning and mitochondrial F1F0-ATPase activity, Mol. Cell. Biochem. 215
(1–2) (2000) 31–37.
[14] J. Li, J. Wang, T. Pan, X. Zhou, H. Yang, L. Wang, G. Huang, C. Dai, B. Yang,
B. Zhang, Y. Zhao, P. Lan, Z. Chen, USP25 deficiency promotes T cell dysfunction
and transplant acceptance via mitochondrial dynamics, Int. Immunopharmacol.
117 (2023) 109917.
[15] E.T. Hasche, C. Fernandes, S.B. Freedman, R.W. Jeremy, Relation between
ischemia time, infarct size, and left ventricular function in humans, Circulation 92
(4) (1995) 710–719.
[16] T.D. Miller, T.F. Christian, M.R. Hopfenspirger, D.O. Hodge, B.J. Gersh, R.
J. Gibbons, Infarct size after acute myocardial infarction measured by quantitative
tomographic 99mTc sestamibi imaging predicts subsequent mortality, Circulation
92 (3) (1995) 334–341.
[17] D.M. Yellon, D.J. Hausenloy, Myocardial reperfusion injury, N. Engl. J. Med. 357
(11) (2007) 1121–1135.
[18] K. Chinda, S. Palee, S. Surinkaew, M. Phornphutkul, S. Chattipakorn,
N. Chattipakorn, Cardioprotective effect of dipeptidyl peptidase-4 inhibitor during
ischemia-reperfusion injury, Int. J. Cardiol. 167 (2) (2013) 451–457.
CRediT authorship contribution statement
Fang-fang Bi: Writing – original draft, Validation, Software, Meth­
odology, Data curation. Miao Cao: Writing – original draft, Supervision,
Software, Methodology, Data curation. Qing-ming Pan: Writing –
original draft, Methodology, Data curation. Ze-hong Jing: Writing –
original draft, Supervision, Methodology. Li-fang Lv: Writing – original
draft, Supervision, Project administration, Funding acquisition. Fu Liu:
Writing – original draft, Methodology, Investigation, Data curation. Hua
Tian: Supervision, Software, Resources. Tong Yu: Supervision, Soft­
ware, Resources. Tian-yu Li: Software, Project administration, Investi­
gation. Xue-lian Li: Software, Methodology, Investigation. Hai-hai
Liang: Methodology, Investigation, Formal analysis. Hong-li Shan:
Writing – review & editing, Investigation, Funding acquisition. Yu-hong
Zhou: Writing – review & editing, Visualization, Resources, Funding
acquisition.
8
F.-f. Bi et al.
Biochemical Pharmacology 226 (2024) 116338
[19] S. Lecour, I. Andreadou, H.E. Bøtker, S.M. Davidson, G. Heusch, M. Ruiz-Meana,
R. Schulz, C.J. Zuurbier, P. Ferdinandy, D.J. Hausenloy, IMproving Preclinical
Assessment of Cardioprotective Therapies (IMPACT) criteria: guidelines of the EUCARDIOPROTECTION COST action, Basic Res. Cardiol. 116 (1) (2021) 52.
[20] E. Murphy, C. Steenbergen, Mechanisms underlying acute protection from cardiac
ischemia-reperfusion injury, Physiol. Rev. 88 (2) (2008) 581–609.
[21] A.M. Orogo, A.B. Gustafsson, Cell death in the myocardium: my heart won’t go on,
IUBMB Life 65 (8) (2013) 651–656.
[22] M. Gale, Y. Li, J. Cao, Z.Z. Liu, M.A. Holmbeck, M. Zhang, S.M. Lang, L. Wu, M. Do
Carmo, S. Gupta, K. Aoshima, M.P. DiGiovanna, D.F. Stern, D.L. Rimm, G.S. Shadel,
X. Chen, Q. Yan, Acquired resistance to HER2-targeted therapies creates
vulnerability to ATP synthase inhibition, Cancer Res. 80 (3) (2020) 524–535.
[23] N. Mnatsakanyan, E.A. Jonas, The new role of F(1)F(o) ATP synthase in
mitochondria-mediated neurodegeneration and neuroprotection, Exp. Neurol. 332
(2020) 113400.
[24] Z.H. Wang, X.L. Cai, L. Wu, Z. Yu, J.L. Liu, Z.N. Zhou, J. Liu, H.T. Yang,
Mitochondrial energy metabolism plays a critical role in the cardioprotection
afforded by intermittent hypobaric hypoxia, Exp. Physiol. 97 (10) (2012)
1105–1118.
[25] M. Boerries, P. Most, J.R. Gledhill, J.E. Walker, H.A. Katus, W.J. Koch, U. Aebi, C.
A. Schoenenberger, Ca2+ -dependent interaction of S100A1 with F1-ATPase leads
to an increased ATP content in cardiomyocytes, Mol. Cell Biol. 27 (12) (2007)
4365–4373.
[26] C. Du, Y. Weng, J. Lou, G. Zeng, X. Liu, H. Jin, S. Lin, L. Tang, Isobaric tags for
relative and absolute quantitationbased proteomics reveals potential novel
biomarkers for the early diagnosis of acute myocardial infarction within 3 h, Int. J.
Mol. Med. 43 (5) (2019) 1991–2004.
[27] Y. Li, B. Chen, X. Yang, C. Zhang, Y. Jiao, P. Li, Y. Liu, Z. Li, B. Qiao, W. Bond Lau,
X.L. Ma, J. Du, S100a8/a9 signaling causes mitochondrial dysfunction and
cardiomyocyte death in response to ischemic/reperfusion injury, Circulation 140
(9) (2019) 751–764.
9